ID: 1062222229

View in Genome Browser
Species Human (GRCh38)
Location 9:135422874-135422896
Sequence CCTCCTATGAAGGAGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062222219_1062222229 22 Left 1062222219 9:135422829-135422851 CCAGGACCCAGGCTTCTCGGAGG No data
Right 1062222229 9:135422874-135422896 CCTCCTATGAAGGAGCAGAAAGG No data
1062222222_1062222229 16 Left 1062222222 9:135422835-135422857 CCCAGGCTTCTCGGAGGGTAAAT No data
Right 1062222229 9:135422874-135422896 CCTCCTATGAAGGAGCAGAAAGG No data
1062222216_1062222229 29 Left 1062222216 9:135422822-135422844 CCCAGAGCCAGGACCCAGGCTTC No data
Right 1062222229 9:135422874-135422896 CCTCCTATGAAGGAGCAGAAAGG No data
1062222217_1062222229 28 Left 1062222217 9:135422823-135422845 CCAGAGCCAGGACCCAGGCTTCT No data
Right 1062222229 9:135422874-135422896 CCTCCTATGAAGGAGCAGAAAGG No data
1062222223_1062222229 15 Left 1062222223 9:135422836-135422858 CCAGGCTTCTCGGAGGGTAAATG No data
Right 1062222229 9:135422874-135422896 CCTCCTATGAAGGAGCAGAAAGG No data
1062222225_1062222229 -10 Left 1062222225 9:135422861-135422883 CCTCGCAGCCTTTCCTCCTATGA No data
Right 1062222229 9:135422874-135422896 CCTCCTATGAAGGAGCAGAAAGG No data
1062222224_1062222229 -9 Left 1062222224 9:135422860-135422882 CCCTCGCAGCCTTTCCTCCTATG No data
Right 1062222229 9:135422874-135422896 CCTCCTATGAAGGAGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062222229 Original CRISPR CCTCCTATGAAGGAGCAGAA AGG Intergenic
No off target data available for this crispr