ID: 1062222883

View in Genome Browser
Species Human (GRCh38)
Location 9:135428054-135428076
Sequence CAAGTTTCCCAGGCATCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062222883_1062222885 27 Left 1062222883 9:135428054-135428076 CCAAGAGATGCCTGGGAAACTTG No data
Right 1062222885 9:135428104-135428126 ATATTAATTGCAGAACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062222883 Original CRISPR CAAGTTTCCCAGGCATCTCT TGG (reversed) Intergenic
No off target data available for this crispr