ID: 1062222885

View in Genome Browser
Species Human (GRCh38)
Location 9:135428104-135428126
Sequence ATATTAATTGCAGAACTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062222884_1062222885 17 Left 1062222884 9:135428064-135428086 CCTGGGAAACTTGAAAAAATATT No data
Right 1062222885 9:135428104-135428126 ATATTAATTGCAGAACTCACTGG No data
1062222883_1062222885 27 Left 1062222883 9:135428054-135428076 CCAAGAGATGCCTGGGAAACTTG No data
Right 1062222885 9:135428104-135428126 ATATTAATTGCAGAACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062222885 Original CRISPR ATATTAATTGCAGAACTCAC TGG Intergenic
No off target data available for this crispr