ID: 1062227814

View in Genome Browser
Species Human (GRCh38)
Location 9:135463457-135463479
Sequence GCCAATGCACAGCTGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062227809_1062227814 14 Left 1062227809 9:135463420-135463442 CCTGAGGAGTCAGCTGATCAGAC No data
Right 1062227814 9:135463457-135463479 GCCAATGCACAGCTGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062227814 Original CRISPR GCCAATGCACAGCTGCTGCT GGG Intergenic
No off target data available for this crispr