ID: 1062230359

View in Genome Browser
Species Human (GRCh38)
Location 9:135479165-135479187
Sequence GCTCGAGGAGCCGCCGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062230350_1062230359 3 Left 1062230350 9:135479139-135479161 CCTCCCCCGAACCTGGCGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG No data
1062230355_1062230359 -3 Left 1062230355 9:135479145-135479167 CCGAACCTGGCGGCAGGTGTGCT 0: 1
1: 0
2: 0
3: 19
4: 92
Right 1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG No data
1062230356_1062230359 -8 Left 1062230356 9:135479150-135479172 CCTGGCGGCAGGTGTGCTCGAGG 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG No data
1062230345_1062230359 28 Left 1062230345 9:135479114-135479136 CCGGGGCAGTTCCTAGAAACTGT 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG No data
1062230346_1062230359 17 Left 1062230346 9:135479125-135479147 CCTAGAAACTGTTCCCTCCCCCG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG No data
1062230349_1062230359 4 Left 1062230349 9:135479138-135479160 CCCTCCCCCGAACCTGGCGGCAG 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG No data
1062230352_1062230359 0 Left 1062230352 9:135479142-135479164 CCCCCGAACCTGGCGGCAGGTGT 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG No data
1062230354_1062230359 -2 Left 1062230354 9:135479144-135479166 CCCGAACCTGGCGGCAGGTGTGC 0: 1
1: 1
2: 0
3: 7
4: 129
Right 1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG No data
1062230353_1062230359 -1 Left 1062230353 9:135479143-135479165 CCCCGAACCTGGCGGCAGGTGTG 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062230359 Original CRISPR GCTCGAGGAGCCGCCGCCCC GGG Intronic
No off target data available for this crispr