ID: 1062232648

View in Genome Browser
Species Human (GRCh38)
Location 9:135490696-135490718
Sequence CACAGTGACTGTAAGCCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062232648_1062232653 25 Left 1062232648 9:135490696-135490718 CCAATTGGCTTACAGTCACTGTG No data
Right 1062232653 9:135490744-135490766 CAGGAACCTGCATTTCTTTGTGG No data
1062232648_1062232651 6 Left 1062232648 9:135490696-135490718 CCAATTGGCTTACAGTCACTGTG No data
Right 1062232651 9:135490725-135490747 TCACTCACTAAGAATGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062232648 Original CRISPR CACAGTGACTGTAAGCCAAT TGG (reversed) Intergenic
No off target data available for this crispr