ID: 1062232653

View in Genome Browser
Species Human (GRCh38)
Location 9:135490744-135490766
Sequence CAGGAACCTGCATTTCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062232648_1062232653 25 Left 1062232648 9:135490696-135490718 CCAATTGGCTTACAGTCACTGTG No data
Right 1062232653 9:135490744-135490766 CAGGAACCTGCATTTCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062232653 Original CRISPR CAGGAACCTGCATTTCTTTG TGG Intergenic
No off target data available for this crispr