ID: 1062236306

View in Genome Browser
Species Human (GRCh38)
Location 9:135510155-135510177
Sequence TAACTCCTCCTGGCCGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062236306_1062236310 30 Left 1062236306 9:135510155-135510177 CCAGGCCCGGCCAGGAGGAGTTA No data
Right 1062236310 9:135510208-135510230 CAAAGCGTTAACTAGAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062236306 Original CRISPR TAACTCCTCCTGGCCGGGCC TGG (reversed) Intergenic
No off target data available for this crispr