ID: 1062238052

View in Genome Browser
Species Human (GRCh38)
Location 9:135522032-135522054
Sequence AGGGGCCTTCTCCAGGTGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 2, 1: 0, 2: 2, 3: 27, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062238044_1062238052 24 Left 1062238044 9:135521985-135522007 CCAGGGAAGGGGGAGGCTCTGGA 0: 3
1: 0
2: 10
3: 59
4: 504
Right 1062238052 9:135522032-135522054 AGGGGCCTTCTCCAGGTGTCAGG 0: 2
1: 0
2: 2
3: 27
4: 218
1062238049_1062238052 -7 Left 1062238049 9:135522016-135522038 CCTGAGCCTGATAGAGAGGGGCC 0: 2
1: 1
2: 1
3: 9
4: 136
Right 1062238052 9:135522032-135522054 AGGGGCCTTCTCCAGGTGTCAGG 0: 2
1: 0
2: 2
3: 27
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062238052 Original CRISPR AGGGGCCTTCTCCAGGTGTC AGG Exonic
900542042 1:3207882-3207904 AGGGGTTTGCTCCAGGGGTCGGG - Intronic
900732104 1:4268833-4268855 AGGGGCCTTCTGCAGGCGGTAGG + Intergenic
901435627 1:9245748-9245770 TGGGTCCTTGTCCATGTGTCTGG + Intronic
901686843 1:10947921-10947943 AGGGGCTGACTCCAGGTATCGGG + Exonic
902229981 1:15021679-15021701 AGGGGCCCTCTGCAGGCTTCAGG - Intronic
902855806 1:19203816-19203838 AGGGTCCTTTTCCATTTGTCAGG + Intronic
906524655 1:46487237-46487259 TGTGGGCTTCTCCAGGTATCTGG + Intergenic
907240180 1:53076938-53076960 AGGGGCCTCTGCCAGGGGTCAGG + Intronic
911318795 1:96387009-96387031 AGGGGTTTTCTCTAGTTGTCTGG - Intergenic
911944127 1:104084392-104084414 TGGGCCTTTCTCCAGGTGTTGGG + Intergenic
914316986 1:146522732-146522754 AAGAGCCTTTTCCAGGTGCCTGG - Intergenic
914497369 1:148210628-148210650 AAGAGCCTTTTCCAGGTGCCTGG + Intergenic
915517676 1:156422580-156422602 ATGGTCCAGCTCCAGGTGTCTGG + Intronic
915797635 1:158753380-158753402 AGGAGCATTCTCATGGTGTCAGG + Intergenic
917158760 1:172033237-172033259 AAGGACCTTCTGCAGGTGTGGGG - Exonic
919863169 1:201756744-201756766 TAGTTCCTTCTCCAGGTGTCTGG + Intronic
920296301 1:204959281-204959303 AGGGGCTTGCTGCAGGTGTCAGG - Intronic
921251315 1:213300984-213301006 AGGGACCTTCTTCAGGAGGCAGG - Intergenic
924888219 1:248243432-248243454 AGGGGCCTCCTCCAAGGCTCAGG - Intergenic
1063198849 10:3768276-3768298 AGTGGGTGTCTCCAGGTGTCAGG - Intergenic
1063940143 10:11120136-11120158 AAGCACCTTCGCCAGGTGTCAGG + Intronic
1067030244 10:42875023-42875045 CCAGCCCTTCTCCAGGTGTCCGG - Intergenic
1069637001 10:69930998-69931020 AGGGGCCTTCTCTGGGTCTCAGG + Intronic
1069724311 10:70567469-70567491 AGAGGCCTGCTCCACTTGTCTGG + Exonic
1069881630 10:71597135-71597157 AGGGGAGTTCTCCAGGTGGAAGG + Intronic
1070777737 10:79119702-79119724 AGGGGCTTTTACCAGGTGACAGG + Intronic
1070873493 10:79779456-79779478 AGGAGCCTTCTCCAAGCGGCGGG + Intergenic
1071076142 10:81755333-81755355 AGAGGCCATATGCAGGTGTCTGG + Intergenic
1071486580 10:86106477-86106499 AGGGGCCTGCTTCAGGTGTGGGG + Intronic
1071486589 10:86106508-86106530 ATGGGCCTGCTTCAGGTGTGGGG + Intronic
1071486598 10:86106539-86106561 ATGGGCCTGCTTCAGGTGTGGGG + Intronic
1071509410 10:86251736-86251758 ACAGGCCTTCACCAGGGGTCAGG + Intronic
1075654604 10:124152790-124152812 AGGGGCTTTCTGTGGGTGTCGGG - Intergenic
1075702654 10:124479197-124479219 AGGGGCCTTCTGCAGGGTCCTGG - Intronic
1076442700 10:130491279-130491301 AGGGGCCTCCTCCTGCTGCCTGG + Intergenic
1076845852 10:133069230-133069252 AGGGGCCGTCAGCAGGTCTCAGG + Intergenic
1077160032 11:1108445-1108467 TGGGGCCTCCTCCAGGTGGGGGG + Intergenic
1077291190 11:1794951-1794973 AGGGAACTTCTCCAGGTCTCCGG + Intergenic
1077324953 11:1959664-1959686 AGGGGTCTTGCCCAGGTGTGGGG - Intronic
1077610220 11:3639320-3639342 AGGGGACTGCTTCAGGTCTCAGG - Intronic
1078362652 11:10681085-10681107 AGGGGCCTCCAGGAGGTGTCGGG - Intronic
1080304933 11:30825986-30826008 TGGAGCCTCCTCCAGGTGCCAGG - Intergenic
1083742523 11:64718401-64718423 AGGGGCCTCCTCCAGGCGCCAGG + Intronic
1083743181 11:64721912-64721934 AGGGGCTTTTTCTTGGTGTCTGG - Intronic
1084342667 11:68517257-68517279 AGAGGCTTTCTGGAGGTGTCTGG + Intronic
1084501317 11:69537258-69537280 TGGCTCCTTCTCCAGGTGCCTGG - Intergenic
1086951092 11:92890781-92890803 TGGGGCCTTCTCCTGCAGTCTGG - Exonic
1089080586 11:115773334-115773356 AGAGGCCTTCTCCAAGTGTCAGG + Intergenic
1202807935 11_KI270721v1_random:14843-14865 AGGGGTCTTGCCCAGGTGTGGGG - Intergenic
1094364447 12:29665206-29665228 AAGGGCCTCCTCCAGGTGAAGGG - Intronic
1096208308 12:49741883-49741905 AGGGGCCTTCGCCAGCGCTCTGG - Exonic
1096809681 12:54161435-54161457 AGGGGCCTTCCCCAGGCACCAGG + Intergenic
1101466866 12:104958178-104958200 AGGGGCATTCACCTGGTGCCCGG + Intronic
1101841199 12:108328635-108328657 AGGGGGCCTCTTCAGCTGTCAGG - Intronic
1102201352 12:111059865-111059887 AGGGGGCTTCCCCAGAAGTCAGG - Intronic
1102705732 12:114878786-114878808 AGCAGTCTTCTCCAGGTGTTGGG + Intergenic
1102795917 12:115688708-115688730 TGGGGCCTTTTCCAGATGTTAGG - Intergenic
1102864216 12:116361286-116361308 TGGGGTCTTCTCCAGGCCTCTGG + Intergenic
1103716199 12:122946837-122946859 AGGGGCCTCTTCCAGGACTCTGG - Intronic
1103910861 12:124351352-124351374 AGGGTCCAGCTCCAGCTGTCAGG - Intronic
1104718579 12:131032101-131032123 AATGTCCTTCTCCAAGTGTCAGG + Intronic
1104946334 12:132416469-132416491 AGGGGCCATCTCCAGATGTGGGG + Intergenic
1107101674 13:36599967-36599989 AGAGGCATTCCCCAGTTGTCTGG + Intergenic
1112285947 13:98104594-98104616 AGGAGCTGTCTCCAGTTGTCTGG + Intergenic
1113936507 13:113997773-113997795 AGTGGCCTTCTCTAGGGGACGGG + Intronic
1114130746 14:19788824-19788846 AGGGGCTGTCTCTAAGTGTCTGG + Intronic
1117046243 14:51816396-51816418 AGGGGTCTTCCCCTGGAGTCAGG + Intergenic
1118501099 14:66363344-66363366 AGGGGGCTTCTCGGGGTGCCTGG + Intergenic
1120859478 14:89241902-89241924 AGGGGCTTTCTCCATGGGTGGGG - Intronic
1121933323 14:97993328-97993350 AGGGGCCTTCTTCAGATGACAGG + Intergenic
1122075448 14:99232055-99232077 TGGGTCCGCCTCCAGGTGTCTGG + Intronic
1123103328 14:105820414-105820436 ATGGGCCTGTCCCAGGTGTCTGG + Intergenic
1123573800 15:21644455-21644477 AGGGGCTGTCTCTAAGTGTCTGG + Intergenic
1123610418 15:22087040-22087062 AGGGGCTGTCTCTAAGTGTCTGG + Intergenic
1123713395 15:23007949-23007971 AGGGGCATTCTCTAGGAGGCAGG + Intronic
1124372467 15:29111419-29111441 AGGGGCTTTCTCCAGGATACAGG + Intronic
1128699737 15:69795425-69795447 AGGGGCCTGCCCTGGGTGTCAGG + Intergenic
1131353453 15:91722701-91722723 AATGGACTTCTCCAGGTCTCTGG - Intergenic
1202982665 15_KI270727v1_random:378794-378816 AGGGGCTGTCTCTAAGTGTCTGG + Intergenic
1132702065 16:1226204-1226226 AGGCGCCCCCTCCAGGTGTGCGG - Intergenic
1132706249 16:1244663-1244685 AGGCGCCCCCTCCAGGTGTGCGG + Intergenic
1134266007 16:12693123-12693145 AGGTGCCTTCTCCAGGTCTTCGG - Intronic
1135077702 16:19408412-19408434 AGGGGCATTCTCCCAGTGTCAGG - Intergenic
1136033674 16:27521557-27521579 AAGGGCGCTCCCCAGGTGTCTGG + Intronic
1137759209 16:50927089-50927111 AGGGCACCTCTCCAGCTGTCAGG + Intergenic
1138383277 16:56618252-56618274 CGGGGCCATCTCCAGGAATCTGG + Intergenic
1138384436 16:56626539-56626561 CGGGGCCATCTCCAGGAATCTGG + Intronic
1138385534 16:56633413-56633435 CGGGGCCATCTCCAGGAATCTGG + Intronic
1138386092 16:56636512-56636534 CGGGGCCATCTCCAGGAATCTGG + Intergenic
1138386554 16:56639337-56639359 TGGGGCCATCTCCAGGAATCTGG + Intronic
1138390525 16:56667282-56667304 CGGGGCCATCTCCAGGAATCTGG - Intronic
1138391135 16:56670579-56670601 CGGGGCCATCTCCAGGAATCTGG + Intronic
1138648455 16:58442662-58442684 AGGGGCTGTCTCTAGTTGTCTGG + Intergenic
1138848745 16:60600047-60600069 AGGGGCCCTCTGCAGATTTCTGG - Intergenic
1140139986 16:72246430-72246452 ATGTGCCTTGTCCAGGTGTCTGG - Intergenic
1141002832 16:80324258-80324280 AGTGGTCTTCTCCAGGACTCCGG - Intergenic
1141883989 16:86879341-86879363 CGGGCCTTTCTGCAGGTGTCAGG - Intergenic
1142171212 16:88623860-88623882 CGTGGCCTTCTCCATGGGTCTGG + Intronic
1142403794 16:89874432-89874454 AGGGGCCTTCTCTCGGTTCCAGG + Intronic
1142795277 17:2302920-2302942 AGGTGCCTTCTCTAGGTTTGCGG - Intronic
1143660159 17:8319577-8319599 AGGGGTCTTGTGCAGGTGTTTGG - Exonic
1144046846 17:11461694-11461716 AGGGGCTGTCTCTAGTTGTCTGG + Intronic
1144147356 17:12411540-12411562 AGGGGCCATCCCCAGATGTCTGG - Intergenic
1144147715 17:12414222-12414244 AGGGGCCATCCCCAGATGTCTGG + Intergenic
1146055483 17:29578687-29578709 AGGGGCCAGCTTCAAGTGTCAGG + Intronic
1146372811 17:32275849-32275871 TGGAGGCTTCTCCAGCTGTCAGG + Intronic
1147428003 17:40355454-40355476 GGGGGCCTGGGCCAGGTGTCGGG - Intronic
1147862185 17:43530114-43530136 CTGGGCCCTCTCCAGGTGACGGG - Exonic
1149836618 17:59918788-59918810 AGAGGCCTTCTTTAGATGTCTGG + Intronic
1151252033 17:72843573-72843595 AGGGTCCTTCTCCGGGTTGCAGG - Intronic
1152040573 17:77900037-77900059 AGAGGCCTTGACCAGGTATCTGG - Intergenic
1152388663 17:79990284-79990306 AGGGGCCGGCTCCAGGTGGTGGG + Intronic
1152514106 17:80812064-80812086 TGGGGCCTCCTCCAGGTGCTGGG + Intronic
1155367382 18:25062193-25062215 ACGGGCCTTATCCAGCTGTGGGG + Exonic
1155779109 18:29808728-29808750 AGGGGCCATCTTCAGGTCTCTGG - Intergenic
1156025371 18:32647715-32647737 ATGGGCCTTTTCCAGGTCTTTGG - Intergenic
1157138810 18:45084952-45084974 AGGGGCCTGGGCTAGGTGTCTGG - Intergenic
1157305987 18:46518110-46518132 AGGGGCCGCCTCCAGGTACCTGG + Exonic
1157696967 18:49730689-49730711 AGGGGCCTTCTGCAGCTGGCAGG - Intergenic
1158946854 18:62454458-62454480 TGGGCCCTTCACCAGGAGTCGGG + Intergenic
1161729396 19:5949982-5950004 AGAGGCCTTCTGCAGGTGCCTGG - Intronic
1162896641 19:13768527-13768549 CGGGGCCTTCTCCTGGTGGGTGG + Intronic
1163327544 19:16614817-16614839 GGGGGCTTCCTCCAGGGGTCTGG + Intronic
1164266738 19:23625835-23625857 ACGGGGTTTCTCCATGTGTCAGG - Intronic
1164791516 19:30989274-30989296 AGAGGCCTTCTTCATGTGGCTGG + Intergenic
1164799384 19:31063473-31063495 AGTAGCCTTCTCCAGAGGTCAGG + Intergenic
1164905802 19:31966966-31966988 AGGGGGCTTCTCGAGGTGACTGG + Intergenic
1168098702 19:54129402-54129424 AGGGGCCTTGCCAAGGTCTCAGG - Intronic
1168113216 19:54206677-54206699 AGAGGCCTTCACAAGGTGTACGG - Intronic
925825019 2:7839420-7839442 AGAAGCCTTGACCAGGTGTCTGG - Intergenic
926537126 2:14127237-14127259 AGGGCTCTTTTCCAGGTGACAGG - Intergenic
926633602 2:15158775-15158797 AAGGGCATTCTCCATGTGGCAGG - Intergenic
927476744 2:23419674-23419696 AGTGGCCTTAACCAGGAGTCTGG + Intronic
929648370 2:43652744-43652766 AGAGGCTTTCTTCAGATGTCTGG - Intronic
932343677 2:70982207-70982229 AGGCGCATCCTCCAGCTGTCTGG - Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
934090758 2:88548643-88548665 AGGGTCCTTTTCCAAGTGTAAGG - Intergenic
934138141 2:89017859-89017881 AGGGGCCCTCTTCTGGTGCCAGG - Intergenic
934143256 2:89068937-89068959 AGGGGCCCTCTTCTGGTGCCAGG - Intergenic
934225986 2:90131618-90131640 AGGGGCCCTCTTCTGGTGCCAGG + Intergenic
934231105 2:90182767-90182789 AGGGGCCCTCTTCTGGTGCCAGG + Intergenic
934614480 2:95762751-95762773 AGGGGCTTTCTCCAACTCTCTGG + Intergenic
934646424 2:96061748-96061770 AGGGGCTTTCTCCAACTCTCTGG - Intergenic
934839829 2:97617830-97617852 AGGGGCTTTCTCCAACTCTCTGG - Intergenic
935913654 2:107925309-107925331 AGGGGGCTTCTAGAGGTGACTGG - Intergenic
936596674 2:113854774-113854796 AGGGTCCTCCTCCAGGTGCGCGG - Intergenic
936865680 2:117074040-117074062 AGGGGCTGTCTCCAGTTGTCTGG - Intergenic
937598217 2:123695885-123695907 TGTGGCCTTTTCCAGGTTTCTGG - Intergenic
938665468 2:133530880-133530902 AGTGGCCTTGACCAGGTATCTGG - Intronic
941951179 2:171159787-171159809 AGGGGCATCCTCCAGGTCCCGGG + Intronic
946881692 2:224182923-224182945 ATAGGCCTTCTCCATGTGGCAGG - Intergenic
948661700 2:239511049-239511071 GGGGGCCTTCTGCAGCTCTCTGG + Intergenic
948789264 2:240368970-240368992 TGGGGCCAACTCCTGGTGTCAGG + Intergenic
1171462158 20:25304235-25304257 CGGGTCCTGCTCCAGGTGCCAGG - Intronic
1172131848 20:32661218-32661240 GTGGGCCTTCTCCAGGTGCCAGG + Intergenic
1175759937 20:61555436-61555458 AGGGTCCTGCTCCAGGTAGCAGG - Intronic
1176168226 20:63685600-63685622 AGGGGCCACCTCCAGGAGGCAGG + Intronic
1179081507 21:38174798-38174820 AGGGGCTGTCTCTAGCTGTCTGG - Intronic
1181173471 22:21023104-21023126 AGGGGCCTCCTGCAGGTGGAAGG - Exonic
1184433198 22:44453722-44453744 TCGGGCCTCATCCAGGTGTCAGG + Intergenic
1185314012 22:50170992-50171014 AGGGGGCGTCCGCAGGTGTCCGG + Intronic
949711737 3:6878709-6878731 GGGCCCCTTCTCCAGGTGTAAGG + Intronic
950550775 3:13664574-13664596 AGGGGCCTTCTTCAGCTTGCAGG + Intergenic
953881110 3:46691918-46691940 AGGGGGCTTCTCTGGGTGTGGGG + Intronic
954100653 3:48370033-48370055 AGGGGCCGTCTCCAGTTGTCTGG + Intergenic
954360803 3:50121823-50121845 AGGGGCTCTCTCCACGTCTCTGG + Intergenic
955389841 3:58513727-58513749 AGGGGCATTCTTCAGGTGTTTGG + Intronic
956090499 3:65661558-65661580 AGTGGCTTGCTCAAGGTGTCTGG - Intronic
960490368 3:118310508-118310530 AGGGGCTGTCTCCAGTTGTCTGG + Intergenic
961462534 3:127061660-127061682 TGGGGCTTTCTGCAGATGTCTGG + Intergenic
966135097 3:176689363-176689385 ACGGTCATTCTACAGGTGTCAGG - Intergenic
967115190 3:186331243-186331265 CGGGGCCTTCCCCAGGTCACAGG + Intronic
967163458 3:186759607-186759629 AGGGGACATCTCCACATGTCTGG - Intergenic
968137261 3:196228288-196228310 AGGTGCCTTCCCCAGGAGCCGGG + Intronic
968684581 4:1948949-1948971 AGGGGCCTTCTGCATGGCTCAGG - Intronic
969176570 4:5403293-5403315 AGGGGCTGTCTCTAGTTGTCTGG - Intronic
969873510 4:10119088-10119110 AGGAGCATCTTCCAGGTGTCAGG - Intergenic
972642108 4:40934291-40934313 AGGGGTTTTCTTCAAGTGTCAGG + Intronic
973566994 4:52198813-52198835 AAGGGCTTTCCCCAGTTGTCTGG - Intergenic
975544213 4:75545368-75545390 AGGAACCTTCTCCAGGCCTCAGG + Intronic
978716708 4:111852825-111852847 AGGTGTCTTTTCCAGGTGTCTGG - Intergenic
980514096 4:133831151-133831173 CGGGGCCTACTCCAGGTGGAGGG + Intergenic
981749661 4:148081859-148081881 AGGGGCCTTCCCAGGGTGTAAGG + Intronic
984288301 4:177761703-177761725 CGGGGACTTCTCCAGGTTCCAGG + Intronic
987158943 5:15120160-15120182 AGTTGGCCTCTCCAGGTGTCAGG + Intergenic
988492687 5:31718003-31718025 TGGGGCCTTCTGAAGGGGTCTGG + Intronic
990989877 5:61674486-61674508 AGGGGCCTGCAGCAGGTCTCAGG - Intronic
992092262 5:73327622-73327644 ATGAGCATTCTCCAGGTGTTGGG - Intergenic
993724327 5:91350993-91351015 TGGGGTGTTCTCCAGGTGTTGGG + Intergenic
999794430 5:154975561-154975583 AGTGGCTTTCCACAGGTGTCAGG + Intergenic
999957401 5:156717727-156717749 AGGGGCTGTCCCCAGTTGTCTGG - Intronic
1001014299 5:168126654-168126676 CGGGGCCTGCTCCAGGGGTCTGG + Intronic
1003660884 6:8060544-8060566 AGGGGCCTACTGCAGGTGGCCGG + Intronic
1007230597 6:40345171-40345193 AGGGGTCTTGTCCAGCTGTGAGG + Intergenic
1007730266 6:43941266-43941288 AGGGCCCTTCTCCTGGGATCTGG + Intergenic
1007838493 6:44696593-44696615 AGAGTCCTGCTCCAGCTGTCAGG + Intergenic
1008734355 6:54524336-54524358 AGGGGCATTGTCCAGCTGTTTGG + Intergenic
1011529807 6:88309470-88309492 AGGGCCCTTTTCCAGGTCGCAGG - Intergenic
1013749216 6:113383105-113383127 AGAGGCCTTGTCCAAGTTTCAGG - Intergenic
1013887625 6:114989118-114989140 ATGTGCCTTGTCCAGGTGCCAGG + Intergenic
1016639044 6:146327724-146327746 AGGGCTCTTCTCCAGGCTTCCGG + Intronic
1017679176 6:156846464-156846486 AGAGGCCTTCTTGAGGTGTCTGG + Intronic
1017783408 6:157734174-157734196 AGGGGTCACCTCCAAGTGTCAGG + Intronic
1017984959 6:159435734-159435756 AGGGGCTGTTTCCAGTTGTCTGG - Intergenic
1018389672 6:163332453-163332475 AGGGAGCTTCTTTAGGTGTCAGG - Intergenic
1018735105 6:166681797-166681819 AGGCACCTGCTGCAGGTGTCAGG - Intronic
1019257473 7:61374-61396 AGGGGCCTCCCCCACGTGCCTGG + Intergenic
1019312042 7:367606-367628 AGGGGGCCTCTCCAGGCCTCAGG + Intergenic
1019642819 7:2113678-2113700 GGAGGCCTTCGCCAGGTGACCGG + Intronic
1019675873 7:2312316-2312338 AGGGGTCCTCTGCAGGTGTAGGG - Intronic
1020110073 7:5443029-5443051 AGGTGCCCTCTCCAGGTGGACGG - Intronic
1021843381 7:24741462-24741484 AGGGGTCAGCTCCAGGTATCCGG + Intronic
1022147902 7:27565155-27565177 AGGGGCTATCTCTAAGTGTCTGG - Intronic
1023152549 7:37215588-37215610 ATGGGCTGTCTCCAGTTGTCTGG - Intronic
1027570332 7:79858543-79858565 AGGGGCTTTCTCTTGTTGTCTGG + Intergenic
1028531390 7:91842341-91842363 AGTGGTCTTCTCCTGGAGTCTGG - Intronic
1031533678 7:122908028-122908050 AGGAACCCTCTCCTGGTGTCTGG - Intergenic
1033289323 7:140069646-140069668 AGGGGCTGTCCCCAGTTGTCTGG - Intergenic
1034349782 7:150408274-150408296 CAGGGCCATCTCCAGGGGTCGGG - Intronic
1034637964 7:152582282-152582304 AATGGCCTTCACCAGGTGACGGG - Intergenic
1034885478 7:154795218-154795240 AGAGGCCTGCTCCAGGGGCCCGG + Intronic
1035211980 7:157335844-157335866 ACGGGGTTTCTCCATGTGTCAGG + Intronic
1036595158 8:10205310-10205332 AGGGGGATGCTACAGGTGTCTGG + Intronic
1037439650 8:18902910-18902932 AGGGGATTTCTCTAGGTGTCAGG + Intronic
1038034986 8:23679951-23679973 AGTGACCTTCTCAAGCTGTCAGG + Exonic
1039567407 8:38561132-38561154 AGTGGCCTTCTCCTGGTGGATGG + Intergenic
1041471327 8:58212369-58212391 CTGGGCCATCCCCAGGTGTCTGG - Intergenic
1043361280 8:79475313-79475335 AGGGTCCTTCTGCAGATCTCTGG - Intergenic
1047185392 8:122628473-122628495 AGGGCCAGTCTCCAGGTGACAGG + Intergenic
1048457012 8:134587535-134587557 AGGGACCTGATGCAGGTGTCTGG + Intronic
1048556660 8:135484395-135484417 AGGGGCCTAGCCCAGGTGTCAGG - Intronic
1049211473 8:141388447-141388469 AAGGACCTTCCTCAGGTGTCCGG - Intergenic
1050203900 9:3177665-3177687 AGGGGCTCTCTCTAGTTGTCTGG - Intergenic
1050950192 9:11581294-11581316 AAGGGCCTTCTCCAGGCTGCAGG + Intergenic
1052343509 9:27385450-27385472 AGGGGCCTTGGTGAGGTGTCAGG + Intronic
1057801895 9:98195887-98195909 TGGGGCCCACTCCTGGTGTCAGG - Intergenic
1058929362 9:109703943-109703965 TGGATCCTTCTCCAGGGGTCTGG - Intronic
1061079374 9:128360984-128361006 AGGGGCCACCTACAGATGTCAGG - Exonic
1061500145 9:130997360-130997382 AGGGGCTGCCACCAGGTGTCAGG + Intergenic
1061514468 9:131080753-131080775 AGGTGACTTCCCCAGGAGTCAGG + Intronic
1061821202 9:133228044-133228066 AGGAACTTTCTCCAGGTGTCAGG - Intergenic
1061834245 9:133318320-133318342 AGGGGCCTTCTCCAGGTGTCAGG + Intergenic
1062238052 9:135522032-135522054 AGGGGCCTTCTCCAGGTGTCAGG + Exonic
1062675915 9:137743745-137743767 CGGGCTCTTCTCCAGGTGGCAGG + Intronic
1187281448 X:17860954-17860976 AGGGGCCTGCTCCCGGGGGCAGG - Intronic
1188900459 X:35726371-35726393 AGGCGCCCTCTCCAGGTGGATGG + Intergenic
1189202660 X:39210947-39210969 AGGATCCTTCTTCAAGTGTCTGG - Intergenic
1189691744 X:43624025-43624047 AGGGGCCTCCTAGGGGTGTCTGG - Intergenic
1198312977 X:135438256-135438278 AGGGTCCTTCTCCAGCTGCAGGG - Intergenic