ID: 1062240453

View in Genome Browser
Species Human (GRCh38)
Location 9:135534771-135534793
Sequence GCGTCGTGACCTCATTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062240453_1062240455 -5 Left 1062240453 9:135534771-135534793 CCCTGTGAATGAGGTCACGACGC No data
Right 1062240455 9:135534789-135534811 GACGCCAGCTCAGCCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062240453 Original CRISPR GCGTCGTGACCTCATTCACA GGG (reversed) Intergenic
No off target data available for this crispr