ID: 1062240723

View in Genome Browser
Species Human (GRCh38)
Location 9:135536377-135536399
Sequence GACTGCAAGGAGAAGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 457}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062240723_1062240732 17 Left 1062240723 9:135536377-135536399 CCCGCCCCCTTCTCCTTGCAGTC 0: 1
1: 0
2: 2
3: 50
4: 457
Right 1062240732 9:135536417-135536439 GGCCAAGCACAGCAGCCAGTTGG 0: 2
1: 0
2: 2
3: 31
4: 266
1062240723_1062240730 -4 Left 1062240723 9:135536377-135536399 CCCGCCCCCTTCTCCTTGCAGTC 0: 1
1: 0
2: 2
3: 50
4: 457
Right 1062240730 9:135536396-135536418 AGTCATGATTACCACGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062240723 Original CRISPR GACTGCAAGGAGAAGGGGGC GGG (reversed) Intergenic
900245028 1:1632689-1632711 GACTGGAAGGAAACGGGGGTGGG - Intronic
900256259 1:1699848-1699870 GACTGGAAGGAAACGGGGGTGGG - Intronic
900335334 1:2160409-2160431 GACTCCGTGGAGAGGGGGGCAGG + Intronic
900430209 1:2597806-2597828 GACAGGAAGGAGAAGATGGCAGG - Intronic
900598377 1:3492766-3492788 ATCTGCAAGGCGGAGGGGGCGGG + Exonic
900665347 1:3811351-3811373 GACTGCAGGGAGGAAGGTGCTGG - Intergenic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
900971934 1:5996576-5996598 GCCTGCAAGGAGACAGGTGCCGG - Intronic
900980665 1:6044377-6044399 GACTTCACGGAGAAGGCAGCAGG + Intronic
901715837 1:11153181-11153203 GAGTGGAAGGGGAAGGGGCCAGG + Intronic
901749554 1:11397463-11397485 GGCTGCAAGAGGAAGGGGACAGG - Intergenic
902410890 1:16210964-16210986 GACAGCAGGGTGAAGGGAGCAGG - Intronic
902576312 1:17379992-17380014 GTCTGCCAGCAAAAGGGGGCAGG + Intronic
902626033 1:17676893-17676915 GGCTCCATGGAGAAAGGGGCAGG - Intronic
902652803 1:17847489-17847511 GGCAGCAAGGAGGAGGGAGCGGG - Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903021358 1:20397536-20397558 GAAGACAAGGAGAAGGGGGCTGG + Intergenic
903222394 1:21876101-21876123 CACTGCATGGAAAAGGTGGCTGG - Intronic
903829896 1:26168500-26168522 GGCTGCAGGGGGAAGGGGCCTGG + Intergenic
903973755 1:27136290-27136312 GTCTGCTGGGAGCAGGGGGCAGG + Intronic
904055115 1:27664949-27664971 GGGTGAAAGGAGATGGGGGCGGG + Intergenic
904139506 1:28341266-28341288 CACTGCAAGGAGAAGAAAGCTGG - Intergenic
904750955 1:32741489-32741511 GACGGAAAGGGGAAGGGCGCAGG - Intergenic
905032921 1:34899777-34899799 GACTGCTAGGAGGTGGGGGAGGG + Intronic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
906343655 1:45002149-45002171 GACTGCAACGGGTTGGGGGCAGG + Intergenic
906497297 1:46314072-46314094 GCCTTAAAAGAGAAGGGGGCCGG + Intronic
907776627 1:57522255-57522277 GACTGCATGGGGAAGGGGAGGGG - Intronic
911126169 1:94343130-94343152 CACTCCAAAGAGAAGGGAGCGGG - Intergenic
911536290 1:99105070-99105092 CACTGCCAGGAGAAGGGGAGAGG - Intergenic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913535732 1:119770298-119770320 GACTGCAAGAATAAGGGCACTGG - Intergenic
915275197 1:154783692-154783714 GACTGGAAGGAGAGGGGAGCTGG + Intronic
915323156 1:155067082-155067104 GCCTGGAAGGAGGAGGGGGCTGG + Intronic
915493858 1:156267245-156267267 GGCAGTAAGGAGAAGGGGGAAGG + Intronic
916091167 1:161308944-161308966 GACATCAAGGGAAAGGGGGCTGG - Intronic
917672878 1:177289892-177289914 GACTGCCAGGAGTTGGGGGCTGG - Intergenic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918550644 1:185738280-185738302 GACTGAAAGCTGAAGGGTGCAGG - Intronic
920420526 1:205830196-205830218 GACTGCCAGGAGCATGGGGTAGG + Intronic
920420880 1:205832555-205832577 GGCTGGAGGGAGGAGGGGGCTGG - Intronic
920497458 1:206465426-206465448 GACTGCAGGGAGAATGGGGATGG + Intergenic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
922145753 1:222942543-222942565 CACTGAAAGGAGAGGTGGGCAGG + Intronic
922447002 1:225706189-225706211 GACGGGAAGGAGAGGGGGCCAGG + Intergenic
922618558 1:226977428-226977450 ACCTGCAAGGAGGAGGGGGCGGG - Exonic
922745226 1:228039470-228039492 GCCTGCCAGGAGAAGGGGGTTGG - Intronic
922790051 1:228306351-228306373 GGCTGCAGGGGGCAGGGGGCAGG - Exonic
923321967 1:232843375-232843397 GACTGGAGCTAGAAGGGGGCAGG + Intergenic
923600183 1:235395839-235395861 GATAGCAAGTAGAACGGGGCTGG - Intronic
1062836404 10:639012-639034 GAATGCAAGGAGGAGGGTCCAGG - Intronic
1064122110 10:12628785-12628807 GATTGGAAGGAGAAGGGGAAGGG - Intronic
1065664337 10:28041725-28041747 GACAGCAAGGAGGAGGTGGAAGG + Intergenic
1066656862 10:37704817-37704839 GACTTCAGGGAGACTGGGGCAGG + Intergenic
1067010825 10:42712014-42712036 GACTGTAAGGAGTGGAGGGCAGG + Intergenic
1067039263 10:42940303-42940325 GAGTCCAAGGAGAAGGGAGATGG - Intergenic
1067079094 10:43203553-43203575 GCCTGCAAGGCGAAGGGAACCGG - Intronic
1067684981 10:48460960-48460982 GGCTGCAAGGAGCTGGGGACAGG + Intronic
1069655526 10:70085110-70085132 GACTGGAAGGAGATGGGGAGTGG + Intronic
1069723765 10:70564946-70564968 GGCTGGAGGGAGAAAGGGGCAGG - Intronic
1069840271 10:71335424-71335446 GGCTGCAAGGAGGAGGGGCGTGG + Intronic
1070365444 10:75732583-75732605 GGCTGCACAGAGAAGGGGGATGG - Intronic
1070739596 10:78894103-78894125 GACTGCAAGGGCAAGGGTGTGGG - Intergenic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1070986701 10:80695797-80695819 GACTGAAATGAGATGGGGGCAGG - Intergenic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1072497162 10:95973131-95973153 GTGAGCAAGGAGGAGGGGGCGGG + Intronic
1072897195 10:99377059-99377081 CACTGCAGCGAGAAGGGGACCGG - Exonic
1073082408 10:100868424-100868446 GCCTGCAGGGAGACGGGGCCTGG + Intergenic
1073112619 10:101071735-101071757 ATCTGCATGGAGATGGGGGCAGG + Intergenic
1073541474 10:104319090-104319112 GACTGCAAGGAAAGGGGGCCTGG + Intronic
1073685397 10:105747025-105747047 GGCTGCCAGGAGAAGGGGAAAGG - Intergenic
1074033816 10:109717668-109717690 TTCTGAGAGGAGAAGGGGGCAGG - Intergenic
1074350506 10:112732424-112732446 CACTGCACAGAGAATGGGGCAGG - Intronic
1074469765 10:113716078-113716100 GGCTGCAAGGTCAAGGGGACAGG + Intronic
1074493817 10:113961063-113961085 GGGTGCAAGGAGCAGGGAGCAGG - Intergenic
1076189801 10:128475064-128475086 GGCTGGAAGCAGAAGGGGGACGG - Intergenic
1076214771 10:128684611-128684633 GACTGCACAGTGAATGGGGCTGG + Intergenic
1076366616 10:129925261-129925283 GGGTGCAAGGAGAATGGGGTGGG + Intronic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1076921693 10:133457636-133457658 GAGGGCAGGGAGAAGGGGGGTGG + Intergenic
1076986029 11:236474-236496 GTCGGCAAGGAGGCGGGGGCGGG - Intronic
1077219855 11:1411062-1411084 GGCAGGAAGGAGGAGGGGGCGGG + Intronic
1077290032 11:1784832-1784854 ACCTGCCAGGAGAAGGGGTCTGG - Intergenic
1077870922 11:6260487-6260509 GACTGGGAAAAGAAGGGGGCTGG + Intronic
1078181626 11:9016557-9016579 GCCTGAAGGGAGAAGGAGGCAGG + Intergenic
1078609286 11:12806207-12806229 GAGTGGGAAGAGAAGGGGGCAGG - Intronic
1078923912 11:15857392-15857414 GTCAGCAAGGAGGAGAGGGCTGG + Intergenic
1079004476 11:16782381-16782403 GACCTCATGAAGAAGGGGGCAGG - Intronic
1079382448 11:19949743-19949765 TGCTGCAAGTAGGAGGGGGCCGG - Intronic
1079487476 11:20950514-20950536 GACTCACAGGAGAAGGGGGTTGG + Intronic
1081811744 11:45918034-45918056 GACTTGAGGGAGTAGGGGGCCGG - Intronic
1081911354 11:46701632-46701654 GCCTCCAAGGAGAAGGGCGAGGG + Exonic
1081967508 11:47178518-47178540 GAGTGCAAGGAACACGGGGCTGG + Intronic
1082912818 11:58395971-58395993 CACTGAAAGGAGATGGGGGTGGG + Intergenic
1083053034 11:59793723-59793745 GACTGCAAGGCCAAAGGGACAGG - Intronic
1083196844 11:61093317-61093339 GAGGGCAAGGGGCAGGGGGCAGG + Intergenic
1084499888 11:69529265-69529287 GAAAGCAGGGAGACGGGGGCCGG - Intergenic
1084985998 11:72872446-72872468 GACTGCAGGGAATAGGGGGCTGG - Intronic
1085304129 11:75475643-75475665 GACTGCAGGGAGAAAGGGGCGGG + Intronic
1086542690 11:87931876-87931898 TACTGTAAGCAGAAGGGGCCAGG + Intergenic
1086686609 11:89740857-89740879 GACTGCAGGGAGGAGGGACCGGG - Intergenic
1087144246 11:94796499-94796521 GATTGAAAGGAGAAGGAGCCAGG + Intronic
1087231971 11:95676282-95676304 GACTCCACGGAGAGGGGGCCGGG - Intergenic
1087890051 11:103527672-103527694 AAATGCTAGGAGAAGGGTGCTGG - Intergenic
1088100282 11:106146813-106146835 ATCTGCAAAGAGACGGGGGCTGG - Intergenic
1088339330 11:108745128-108745150 GAGTGGAAGGAGAAGGGAGAAGG - Intronic
1089360640 11:117883998-117884020 GACAGCAAGGAGAAAGGGGGTGG + Intergenic
1089442999 11:118531757-118531779 GGCTGCTGAGAGAAGGGGGCGGG - Exonic
1089662467 11:119994335-119994357 TATTGCAAGGAGAAGGCAGCAGG + Intergenic
1090387003 11:126363185-126363207 GACAGGAAGGAGATGGGGGCAGG - Intronic
1090437453 11:126698503-126698525 GGCTGCAGGGAGAAAGGGGCTGG + Intronic
1090540400 11:127696483-127696505 TCCTGCTAGGAGAAGGGGTCAGG - Intergenic
1090663954 11:128902503-128902525 GTCTGCATGGGGGAGGGGGCTGG + Exonic
1090817948 11:130314943-130314965 GAAGGGGAGGAGAAGGGGGCGGG + Intergenic
1091051106 11:132373553-132373575 CACTGCCAGGAGATGGGGGAGGG - Intergenic
1091295120 11:134468386-134468408 GAATGCGAGGAGAAAGGAGCAGG - Intergenic
1091379662 12:48483-48505 GACTGCAAGGAGGTGTGGGGAGG - Intergenic
1092028484 12:5263220-5263242 CACTGCAAGCAGAAGCAGGCAGG + Intergenic
1092946399 12:13458024-13458046 GGCTTCATGGAGAAGGTGGCAGG - Intergenic
1094656012 12:32419926-32419948 CACTGCTGGGAGAAGGGGGAGGG + Intronic
1095345552 12:41144822-41144844 GACCTCAAGGAGAAAGGGGAAGG - Intergenic
1096183943 12:49566284-49566306 GGCTGGCAGGGGAAGGGGGCTGG - Intronic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1096809071 12:54158300-54158322 TACCACCAGGAGAAGGGGGCTGG + Intergenic
1097687965 12:62708868-62708890 GACTACTAGGAGAAGAGGGAGGG - Intronic
1100995799 12:100299505-100299527 AACTGCAAGGAAAAGGGGACAGG - Intronic
1101387806 12:104273268-104273290 GTCTGCATGTAGAAGGTGGCAGG - Intronic
1102027629 12:109722604-109722626 GACGGGCAGGAGAAGGGGCCAGG + Intronic
1102455891 12:113070552-113070574 GACTCCATGGAGAAGGGGGAGGG - Intronic
1102490641 12:113287891-113287913 TACTGCAAGGAGATGTGGCCTGG + Intronic
1104299254 12:127549328-127549350 GACTCCAGGGAGAGGTGGGCAGG + Intergenic
1104624666 12:130341220-130341242 GACTGGAAAGAGAAGGGGCAAGG - Intronic
1106134621 13:26964894-26964916 GACTGACGGGAGAAGGGTGCAGG + Intergenic
1106248048 13:27965336-27965358 GACACCAAGGGAAAGGGGGCAGG + Intronic
1106360754 13:29028486-29028508 GAGTGGAAGGAGAGGAGGGCAGG - Intronic
1106780858 13:33057592-33057614 GACTGCCAGGAGGAGGGGTGGGG - Intronic
1106838897 13:33665533-33665555 AACTGGCAGGAGAAGGGAGCTGG - Intergenic
1107336321 13:39359622-39359644 GAATACAAGGAGAAGGAGGTAGG + Intronic
1107882294 13:44843268-44843290 GAGTGGGAGGAGAAGGGGGGTGG + Intergenic
1108623065 13:52202841-52202863 GATGGCAAGGAGATGGGGGAAGG - Intergenic
1113635227 13:111914790-111914812 GACTTGAAGGGGAAGGTGGCTGG + Intergenic
1113641763 13:111962708-111962730 GACTTGAAGGAGGAGGAGGCTGG + Intergenic
1114407218 14:22468133-22468155 AACATCAAGGAGAAGGTGGCTGG + Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115028478 14:28767706-28767728 GACGAGAAGGAGAAGGGCGCCGG + Exonic
1115318865 14:32056701-32056723 GAGTGCAAGGAAAAGGGGTAAGG - Intergenic
1115879499 14:37899265-37899287 GTTTGCAAGAGGAAGGGGGCTGG + Intronic
1116009346 14:39332715-39332737 GACTGCAAGCAGAAGCAGGGTGG - Intronic
1117475883 14:56094759-56094781 GACTTCAGAGAGAAGGGGGAAGG - Intergenic
1117486960 14:56207650-56207672 GATTGCTAGGAAAAGAGGGCTGG + Intronic
1117501688 14:56358711-56358733 GCCTGGAAGGACAAGGAGGCAGG - Intergenic
1117732795 14:58740777-58740799 GACTGGAAGGAGTGGGAGGCAGG + Intergenic
1118318171 14:64738048-64738070 GAAGGCAACGAGAAGGGGGCTGG + Intronic
1119514783 14:75239611-75239633 GAGTGGAAGGAGGAGAGGGCTGG - Intronic
1119728377 14:76935961-76935983 GACTGCAAGGCCAAGGGAGCAGG - Intergenic
1120720235 14:87882584-87882606 GAGTGGTAGGAGAAGTGGGCAGG - Intronic
1121080403 14:91103335-91103357 GGCTAAAAGGAGAAGGGGGAAGG - Intronic
1122753978 14:103962634-103962656 GACTCCAAGAAGAAGAGGGAGGG - Intronic
1122854137 14:104552075-104552097 GGCTGCCAGCAGCAGGGGGCCGG - Intronic
1122862792 14:104590026-104590048 GACTGCAGGGCAAAGGGAGCCGG - Intronic
1124882544 15:33655747-33655769 GCCTGGAATGAGAAGGGGGCTGG - Intronic
1126106098 15:45148011-45148033 GACAGCCAGGAGAATGGGCCAGG + Intronic
1127717641 15:61665156-61665178 GACTGCAAGGAGAATGCTGATGG + Intergenic
1128186083 15:65644545-65644567 GACAGCAGGGAGAGGGGGGCAGG - Intronic
1128509356 15:68303884-68303906 ATCTGCAAGGGGAGGGGGGCCGG + Exonic
1128633943 15:69291068-69291090 GACTCCAGGGAGGAGGGGGCTGG - Intergenic
1128866683 15:71119756-71119778 GCCTGCAGGGAGGAAGGGGCTGG - Intronic
1129116523 15:73368158-73368180 GACGCCGAGGAGGAGGGGGCCGG - Exonic
1129296109 15:74600995-74601017 GGCTGCAAGGTGGAGGTGGCTGG + Intronic
1129306412 15:74667420-74667442 GAAAGAAAGGAGAAGGGGGGAGG + Intronic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129677117 15:77637676-77637698 GACTTTAAAGAGAAGGGGTCAGG - Intronic
1130095415 15:80851910-80851932 GACTGGAAGGAGGAGGAGACTGG + Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130738310 15:86572350-86572372 GACTGCAAGGAGGTGTGGTCTGG - Intronic
1131154112 15:90064269-90064291 GACAGCAAGGTGAATGAGGCAGG - Intronic
1132042564 15:98537244-98537266 GACAGCAAGGAGCATGGGACAGG + Intergenic
1132397356 15:101483718-101483740 GACTGGAAGGAGAAAGAAGCAGG + Intronic
1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG + Exonic
1133896953 16:9938824-9938846 GACTCAAAGGAGGAAGGGGCAGG - Intronic
1134352618 16:13451923-13451945 GGCTTCAAGGAGAAGGGGAAGGG + Intergenic
1134455556 16:14392858-14392880 TACTGTAAGAAGAATGGGGCCGG + Intergenic
1136083647 16:27869061-27869083 GACAGCCAGGAGATGGGAGCAGG + Intronic
1136181911 16:28558883-28558905 GACTGAGAGGAGAAGGGGGTGGG + Intronic
1136370661 16:29834045-29834067 GACGGCAAGGAGAGGGTGACAGG + Exonic
1136381196 16:29896792-29896814 GACAGCAAGGGGATGGGGGTGGG - Intronic
1136454220 16:30371230-30371252 GACAGCACGGAGAAGGGGCGGGG + Intronic
1139055527 16:63179074-63179096 GAGTGAAAGGAGAGGGGGGGGGG + Intergenic
1139654390 16:68378529-68378551 GACTGCAGGGAGAAGGAGGCAGG - Intronic
1139776691 16:69320855-69320877 GACTCCAGGGAAAAGGGGCCAGG - Intronic
1139923710 16:70474507-70474529 GCCTGCCAAGAGAAGGGGGAGGG - Exonic
1140255763 16:73334729-73334751 GACTGAGAGGAGGAGGGGACAGG - Intergenic
1141153942 16:81583783-81583805 GAATACAAGGCCAAGGGGGCTGG + Intronic
1141253746 16:82382082-82382104 GAGTCCAAGGTGAAGGTGGCAGG + Intergenic
1141775660 16:86121427-86121449 GATTGCAGGGAGAAGGAGGAGGG - Intergenic
1142667413 17:1470839-1470861 GACTGCCCGGAAAAGGGGGGCGG + Intronic
1142744132 17:1947369-1947391 CGCTGCAGGGTGAAGGGGGCCGG - Intronic
1143097637 17:4486875-4486897 GAAAGGAAGGAGAAAGGGGCCGG + Intronic
1143171374 17:4932515-4932537 AGCTGCAGGGGGAAGGGGGCTGG + Intronic
1143209143 17:5170640-5170662 GCCAGCAAAGAGAATGGGGCTGG + Exonic
1144124977 17:12194864-12194886 GACAGCATGGAGAAGGTGGATGG - Intergenic
1144618626 17:16800112-16800134 GCCAGCAAAGAGAATGGGGCTGG + Intronic
1144854582 17:18260892-18260914 GACCGAGAGGGGAAGGGGGCTGG - Intronic
1144894078 17:18515587-18515609 GCCAGCAAAGAGAATGGGGCTGG - Intergenic
1144995443 17:19264992-19265014 GGAGGGAAGGAGAAGGGGGCAGG + Intronic
1145138154 17:20428673-20428695 GCCAGCAAAGAGAATGGGGCTGG + Intergenic
1145291849 17:21552955-21552977 GACTGCATGGTAGAGGGGGCCGG + Intronic
1146057512 17:29588849-29588871 GAGGGCAAGGAGCAGAGGGCCGG - Intronic
1147047754 17:37767411-37767433 GACTGAAAGGAGAATGGTGGAGG - Intergenic
1147634880 17:41957717-41957739 GAATGCAAGGTGATGGGGGCTGG - Intronic
1148046651 17:44748912-44748934 GGCTGCCAGGGGAAGGGGTCTGG - Intronic
1148108482 17:45131950-45131972 GTCTCCAAGGAGAATGGAGCGGG - Intronic
1148464028 17:47853877-47853899 GACTGCAAGTAGAGGGGGACTGG - Intronic
1148556548 17:48582048-48582070 GGCTGCCAGGAGAAGGCGGCTGG - Intronic
1148562143 17:48612231-48612253 GGCTGCAGAGAGGAGGGGGCGGG - Intronic
1149884542 17:60327611-60327633 GGCTGCAAGGAGATGCGGCCAGG + Intronic
1150608220 17:66712598-66712620 GTCTTTAAGGAGAAGGGGACAGG - Intronic
1151375165 17:73683528-73683550 TACAGCAAAGAGTAGGGGGCAGG - Intergenic
1151456019 17:74226256-74226278 GAGTGAGAAGAGAAGGGGGCTGG + Intronic
1151778047 17:76221995-76222017 GATTGCCAGGGGATGGGGGCAGG + Intronic
1152079314 17:78176680-78176702 GCCTGCAAGGAGCTGTGGGCCGG + Intronic
1152287903 17:79423091-79423113 GTCTGGAAGGAGACTGGGGCTGG - Intronic
1152404362 17:80087990-80088012 GCCTGCATGGGGGAGGGGGCGGG - Exonic
1152465206 17:80462347-80462369 GCCAGCAGGGAGGAGGGGGCTGG + Intergenic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152524428 17:80879420-80879442 GAGTGGGAGGAGAAAGGGGCAGG - Intronic
1152733139 17:81983338-81983360 TCCTGCAAGCAGAAGGGAGCAGG - Intronic
1154052422 18:10973702-10973724 GAATGGAAAGAGAAGGGGACGGG + Intronic
1154357363 18:13632249-13632271 GCCTGCCAGGGGAAGTGGGCAGG - Intronic
1154492658 18:14933485-14933507 GACTGCAGGGAGCAAGGGCCAGG + Intergenic
1155403495 18:25463327-25463349 AACTGCATGGAGCAGGGGGTGGG + Intergenic
1156355836 18:36339287-36339309 GAATGCAAGCAGATGAGGGCAGG + Intronic
1157410011 18:47455619-47455641 GGCTGCAAAGAGAAGTGGGAAGG - Intergenic
1157516398 18:48314777-48314799 GACAGCTGGGAGAAGGGTGCAGG + Intronic
1157563146 18:48662572-48662594 GCCTCCAAGCAGAAGGGGCCAGG - Intronic
1158602192 18:58864304-58864326 GACGGAAGGGAGGAGGGGGCTGG + Intronic
1158633332 18:59135017-59135039 GATTGCAAGGAGCATAGGGCAGG + Intergenic
1158782792 18:60670794-60670816 GTCCGCAAGGAGACAGGGGCTGG - Intergenic
1160833466 19:1113782-1113804 GAGGGCAAGGACAAGGGGCCCGG + Intronic
1160972226 19:1774720-1774742 GGCTCCATGGAGAAGGGGGCTGG + Intronic
1161444739 19:4311811-4311833 GACGGAAAGGAGAGGGGGTCGGG - Intronic
1161586368 19:5107960-5107982 GACTGGAAGGAGGTGGCGGCTGG - Intronic
1161619643 19:5291329-5291351 TCCTGCATGGAGGAGGGGGCTGG + Intronic
1162083596 19:8234848-8234870 GACAGAAAGTAGAATGGGGCCGG - Intronic
1162477212 19:10907822-10907844 GACTGACATGAGAAGAGGGCAGG - Intronic
1163091985 19:15026637-15026659 GACAGCAAGGTGAGGGTGGCAGG - Intergenic
1163204887 19:15795167-15795189 GAAGGCAAGGAGGAGGGGGGAGG - Intergenic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1163787069 19:19280158-19280180 GACTGCGGGGACAAGGGGACGGG - Intronic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1165768996 19:38367612-38367634 GAGTGGAAGGAGATGGGTGCAGG + Intronic
1166384436 19:42372471-42372493 GACTGGAGAGAGAAGGTGGCGGG - Intronic
1166546072 19:43635554-43635576 GTCCGGAAGGAAAAGGGGGCTGG - Intronic
1166662977 19:44659233-44659255 GACTCCTAGGAGGAGGTGGCAGG + Intronic
1167042257 19:47028937-47028959 GACTGTAGGGAGGATGGGGCAGG + Intronic
1167253826 19:48415565-48415587 GACTCCTAGGGGAAGGGGGCAGG + Intronic
1167253855 19:48415636-48415658 GACTCCTAGGGGAAGGGGGCGGG + Intronic
1167698284 19:51027404-51027426 GGCGGCAGGGAGAAGCGGGCAGG - Intronic
1167738596 19:51311439-51311461 GACTTGAAGGAGGAGGGAGCTGG + Intergenic
1168169513 19:54576311-54576333 GGCTGGGAGGAGACGGGGGCGGG + Intronic
1202682532 1_KI270712v1_random:20548-20570 ACCTGCAAGGAGAAGGAGGACGG - Intergenic
925269293 2:2590978-2591000 CACTGCCAGGAGATGGGGGAGGG - Intergenic
927156914 2:20225743-20225765 GGCTGCAAGAAAAAGGGGGACGG + Intergenic
927843030 2:26457326-26457348 GGCTGGAAGGGCAAGGGGGCAGG + Exonic
929396353 2:41527667-41527689 GCCAGCAAAGTGAAGGGGGCTGG - Intergenic
929429043 2:41871353-41871375 CACTGGAGGGAGGAGGGGGCTGG - Intergenic
929895925 2:45960817-45960839 AACTGCAAGGAGAGTGAGGCAGG - Intronic
931759325 2:65402587-65402609 GAGGGAAAGGAGAAGGGGGTAGG + Intronic
932317676 2:70796664-70796686 GAAAGCAAGGAGATGGGGCCAGG - Intergenic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
933685705 2:85139798-85139820 GCCTGGAAGGAGAAGGGGCCAGG + Intronic
933976564 2:87516672-87516694 GACTGATAGTAGAAGAGGGCTGG - Intergenic
935339020 2:102043178-102043200 GGAAGCAAGGATAAGGGGGCAGG + Intergenic
936317255 2:111434133-111434155 GACTGATAGTAGAAGAGGGCTGG + Intergenic
936354652 2:111739696-111739718 GAAGGGAAGGGGAAGGGGGCTGG + Intergenic
936555917 2:113498910-113498932 GGGTGCGAGGAGGAGGGGGCTGG + Exonic
936564197 2:113570342-113570364 GACTGCAAGGAGGTGTGGGGAGG + Intergenic
937051479 2:118894924-118894946 AACTGCATGGAGAAGAGGGCTGG - Intergenic
937792887 2:125981211-125981233 GACTCCCAGGTGAAGGAGGCTGG - Intergenic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
939575879 2:143893899-143893921 CAATGCAAAGAGAAAGGGGCCGG - Intergenic
940716492 2:157230848-157230870 GTGTGCAAGGAGAAGGAAGCAGG - Intergenic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
942516919 2:176764095-176764117 GACTGCAATGAGAGTGGGCCAGG - Intergenic
942542880 2:177032993-177033015 GACTGACAGGAAAAGTGGGCAGG - Intergenic
943839060 2:192554200-192554222 GAATGGAAGGAGAAGAGGGAGGG + Intergenic
944402564 2:199345080-199345102 AAATGCCAGGAGATGGGGGCAGG - Intronic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
946189197 2:217998847-217998869 GACTGTAGGGAGAAGGTGTCAGG - Intronic
946790299 2:223293918-223293940 GACTGCAAGCAGAAGCAGGGTGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948265374 2:236632033-236632055 GCCTGCAGGGAGAAGAGAGCGGG + Intergenic
948823792 2:240564585-240564607 GAATGCAGGGAGAAGAAGGCTGG + Intronic
948913148 2:241015906-241015928 GAATACAAGGAGAAGGCTGCCGG - Intronic
1169037772 20:2467757-2467779 GTCTGCAAGGAGAAATGGACAGG + Exonic
1170118199 20:12884192-12884214 GACTACAAGGAGAATGTGTCAGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170528280 20:17262942-17262964 GACAGGAAGGAGAAGGAAGCTGG - Intronic
1171942315 20:31343117-31343139 GACTGCAACAAGAAAGAGGCAGG + Intergenic
1171979703 20:31618967-31618989 GGTTGAAAGGAGATGGGGGCCGG + Intergenic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1173114719 20:40230295-40230317 GAGAGCAAAGAGAAAGGGGCAGG + Intergenic
1173375422 20:42478203-42478225 GGGTGAAAGGAGAAGGGGGAAGG + Intronic
1173482674 20:43415864-43415886 GACTGCAAGGCCAGGAGGGCTGG + Intergenic
1174194051 20:48760452-48760474 GTCAGCAAGGAGGATGGGGCAGG - Intronic
1174485017 20:50855573-50855595 GACTGGAAGGGGAAGGGGAAGGG + Intronic
1174579752 20:51563106-51563128 GACGGCGAGAAGAAGGGGGTGGG + Intergenic
1175877885 20:62238868-62238890 GACCGCAGGGGGAAGGGTGCGGG - Intronic
1175895673 20:62334620-62334642 GCCTGCAGGGAGAAGGTGGGAGG + Exonic
1175942670 20:62545140-62545162 CACTGCAAGGAGCAGGGTGTTGG - Intergenic
1176129627 20:63491184-63491206 GCCTGCAGGGAGCAGGGAGCAGG - Intronic
1176129634 20:63491207-63491229 GCCTGCAGGGAGCAGGGAGCAGG - Intronic
1176203986 20:63878213-63878235 GACGGGAAGGAGAACGTGGCCGG + Intronic
1176659593 21:9621968-9621990 GATTGACAGGAGAAGGTGGCAGG + Intergenic
1177646301 21:23903683-23903705 AACAGCAAGGAGAAGGGAGAGGG + Intergenic
1178978464 21:37240951-37240973 GAGTGCAAGGAGAAGGGCCAGGG + Intronic
1179173306 21:38989778-38989800 GACTGAAGCGGGAAGGGGGCTGG + Intergenic
1180021567 21:45131695-45131717 GACTGAAAGGAGAAGTGAGGAGG + Intronic
1180180643 21:46117380-46117402 GCCCTGAAGGAGAAGGGGGCAGG - Exonic
1182116921 22:27761923-27761945 GGCTGCCAGGAGCTGGGGGCAGG + Intronic
1182321681 22:29481822-29481844 GGCTGCAAGGAGTTGGGGGAGGG - Intronic
1183316383 22:37139221-37139243 GACTGCAAGGGAAGGAGGGCAGG + Exonic
1183350213 22:37330736-37330758 GACTGCCAGGGGTTGGGGGCGGG + Intergenic
1183984559 22:41562326-41562348 GACTTCAAGGAAATGGGGGGCGG - Intronic
1184017293 22:41795714-41795736 AGCTGCAGGGAGAAGAGGGCAGG - Exonic
1184336857 22:43858916-43858938 GACTGCATGGAGGAGGAGACAGG - Intronic
1184419352 22:44370531-44370553 GGCTGCCAGGAGACCGGGGCTGG - Intergenic
1184448641 22:44569744-44569766 GGCTGCAAGGAGAAAGAGGCGGG + Intergenic
1184449686 22:44575634-44575656 GATGACAAGGAGAAGGGGGATGG + Intergenic
1184567293 22:45299598-45299620 GGATGCAGGGAGCAGGGGGCAGG + Intergenic
1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG + Intergenic
1185027415 22:48423544-48423566 GGCTGCAAGCAGCACGGGGCAGG - Intergenic
1185314163 22:50171555-50171577 TCCTGCAGGGAGATGGGGGCTGG + Intronic
949895736 3:8766589-8766611 TACTGCAAGGAGTGGTGGGCAGG - Intronic
950029175 3:9840610-9840632 GACAGCACTGAGAAAGGGGCAGG + Exonic
950153266 3:10704569-10704591 GACGGGAAGGAGGAGGGAGCAGG - Intronic
950305207 3:11911488-11911510 GTCTCCATGGAGATGGGGGCAGG - Intergenic
950415964 3:12869194-12869216 GTCTCCATGGAGACGGGGGCGGG - Intronic
950917864 3:16664034-16664056 GACCAAGAGGAGAAGGGGGCGGG + Intronic
951524364 3:23639800-23639822 GACTGCAAGGAGCTGGGGTCAGG + Intergenic
952253775 3:31678278-31678300 GACAGGAAGGACAAGGGTGCAGG + Intronic
953979091 3:47404847-47404869 TGCAGCAAGGAGAAGGGGGAAGG - Intronic
954002211 3:47566645-47566667 GACTTCAAGGAGATTGAGGCTGG - Intronic
954439778 3:50515524-50515546 CACTTCATGGAGAGGGGGGCAGG + Intergenic
954454110 3:50587804-50587826 GGCTGCCAGGAAAAAGGGGCTGG + Intergenic
954581035 3:51703065-51703087 AGCTGCAAGGAGGAGGGTGCTGG - Intronic
954716773 3:52530878-52530900 GGCTGCAGGGAGAAGGGAGCAGG + Intronic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
956160795 3:66350220-66350242 CACTGCAGGGAGTAAGGGGCTGG + Intronic
956168239 3:66412568-66412590 AGCTGCAAAGGGAAGGGGGCTGG + Intronic
956985770 3:74698469-74698491 TACTGCAGAGTGAAGGGGGCTGG - Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
959144938 3:102533183-102533205 GACTACATGGAGAAGGAGGGAGG - Intergenic
960378851 3:116935419-116935441 GAAGCCAAGGGGAAGGGGGCAGG - Intronic
963277802 3:143350183-143350205 GACTGCAGAGAGAAAGGGCCAGG - Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966516636 3:180828248-180828270 TACAGGAAGGAGAAGGCGGCCGG - Intronic
966926816 3:184649719-184649741 GACTGTGAGGAAAAGGGGACAGG - Intronic
966941180 3:184748409-184748431 GAGTGAAAAGAGAAGGGGTCAGG - Intergenic
967654261 3:192027478-192027500 GACAGAAAGGCAAAGGGGGCTGG - Intergenic
968994215 4:3935610-3935632 GTCTGCAGTGAGAAGGGGACAGG - Intergenic
969648469 4:8448141-8448163 GACTGCAAGGAATAGCGGCCCGG - Intronic
972988134 4:44790830-44790852 GGCTGGAAGGAGTAGTGGGCAGG - Intergenic
973570506 4:52234185-52234207 GAAGGGAAGGAGAAAGGGGCAGG - Intergenic
973700697 4:53534143-53534165 TACCCCATGGAGAAGGGGGCAGG + Intronic
974178981 4:58360544-58360566 GACTGCAGGTTGATGGGGGCAGG - Intergenic
974916702 4:68186641-68186663 AAAGGCAAGGAGATGGGGGCAGG + Intergenic
975321183 4:73011552-73011574 AACTGCAAGGAGGTGTGGGCAGG + Intergenic
975940962 4:79645111-79645133 GACTGCAAAGAAAAGGAGGATGG + Intergenic
976178017 4:82373848-82373870 GAGTGGGAGGCGAAGGGGGCAGG - Exonic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976844003 4:89465715-89465737 GATTGCAAGGAGCTGGGGGAGGG + Intergenic
977324740 4:95561005-95561027 GACTGCAGGGAGAGGAGGACTGG + Intergenic
977890043 4:102299126-102299148 GAGTGGGAGGAGAAGGGGACTGG - Intronic
980108179 4:128608255-128608277 GAGTGCAAGGACAAGGGACCTGG + Intergenic
981550400 4:145937016-145937038 GAATGCAGGGAAGAGGGGGCAGG - Intronic
981651917 4:147069904-147069926 GACTGCAAGGAAGAAGGAGCAGG - Intergenic
983653167 4:170053617-170053639 GACTGGAAGAAGAAGGAGGGGGG - Intergenic
984013880 4:174403298-174403320 GACTGCCAGGGGAGGGGGACGGG + Intergenic
984032207 4:174618224-174618246 GACTGCAAGGAGATAAAGGCTGG - Intergenic
984275073 4:177599538-177599560 GACTGCCAGTAAAAAGGGGCGGG + Intergenic
986387497 5:7248892-7248914 TACTGGAAGGTGAGGGGGGCTGG - Intergenic
986816325 5:11415735-11415757 GCCTGCAAGGAGAGGAGTGCTGG - Intronic
990545134 5:56815282-56815304 GACTGGGAGGCGGAGGGGGCGGG - Intergenic
990734091 5:58841099-58841121 GTCTGCAGGGGGCAGGGGGCAGG + Intronic
991933899 5:71783090-71783112 GACTGCCAGGAGATGGCGCCAGG + Intergenic
992409281 5:76489424-76489446 GACTGCATGTAGAAGAGGTCAGG - Intronic
993763012 5:91820189-91820211 GAATGGATTGAGAAGGGGGCCGG + Intergenic
994988996 5:106974658-106974680 TTCTGCAAGGAGAGGGGGGATGG + Intergenic
995106264 5:108381084-108381106 GTGTGCAAGCGGAAGGGGGCCGG - Exonic
996387597 5:122925263-122925285 GAAGGAAAGGAGAAGGGGGAGGG - Intronic
996434105 5:123415159-123415181 GAATGCAAGGAGCAGGAAGCAGG + Intronic
996987581 5:129585192-129585214 GAGGGCAAGCAGAAGCGGGCAGG - Intronic
997691670 5:135831582-135831604 GTCTTAAAGAAGAAGGGGGCAGG + Intergenic
998038775 5:138937721-138937743 GAGTGCAGGGAGTAGGGAGCAGG - Intergenic
998051767 5:139041852-139041874 GACTGTAAGGAGAAGAGGGAGGG + Intronic
998376251 5:141692753-141692775 GACACCGAGGAGGAGGGGGCAGG - Intergenic
999324152 5:150632732-150632754 GATTCCAAGGGGAAGAGGGCAGG - Intronic
999623077 5:153491553-153491575 GACAGCAAAGAGAAGGCAGCTGG - Intronic
999717319 5:154371742-154371764 CAATGCAAGGAGAATGGGGCAGG - Intronic
1000299873 5:159946474-159946496 GACTGGAAGGAGAAATGGGGAGG - Intronic
1000723790 5:164742432-164742454 GACATCAAGGAGGAGGGAGCAGG + Intergenic
1002097999 5:176843424-176843446 GACAGAAAGCAGAAGGGGGTTGG + Intronic
1003504144 6:6725796-6725818 AAATGCAATGAGAAGGGGGATGG - Intergenic
1003824309 6:9935719-9935741 GACTGAATTGAGAAGGGGGTGGG - Intronic
1003985136 6:11427782-11427804 GACTGCAAGGAGAGGGGAGATGG + Intergenic
1004340809 6:14805892-14805914 AACTAGAAGAAGAAGGGGGCAGG + Intergenic
1005757688 6:28940021-28940043 GAATACAAACAGAAGGGGGCAGG - Intergenic
1005894767 6:30168568-30168590 GACTCCACGGGGAAGGGGGTGGG + Intronic
1006444781 6:34074081-34074103 CCCTGCCAGGAGAACGGGGCTGG + Intronic
1006527401 6:34618733-34618755 GACTGTAAGGAAAAGGGTGATGG - Intronic
1006643447 6:35500214-35500236 GACTGACCGGAGAAGGGGCCTGG + Intronic
1006980380 6:38142936-38142958 GCCCACAAGGAGACGGGGGCTGG - Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1010550590 6:77217572-77217594 GACTGAAAGTGGAAGGGGGATGG + Intergenic
1011629836 6:89312594-89312616 GACTGTAATCAGAAGGGGTCTGG + Intronic
1015366837 6:132405056-132405078 GACTGCAAGGGGTTGGGGGAAGG + Intergenic
1016861887 6:148728928-148728950 GATTGCTAGGAGCAGAGGGCAGG + Intergenic
1017489642 6:154933704-154933726 GGCTCCAGGGAGAAGGGGACTGG + Intronic
1018314491 6:162543358-162543380 AACTGGGAGGAGAAGTGGGCGGG - Intronic
1018798788 6:167207163-167207185 GACTGGAAGGAGAAAAGGCCAGG + Intergenic
1018813912 6:167316982-167317004 GACTAGAAGGAGAAAGGGCCAGG - Intergenic
1019772937 7:2895057-2895079 GTCTGCAGGGAGGAGGGGCCAGG + Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019832733 7:3349381-3349403 AACTGGAAGGGGAATGGGGCTGG + Intronic
1019950461 7:4368139-4368161 GACTCCAAGGTGAAGGGGTATGG + Intergenic
1020013590 7:4818827-4818849 GAATGACAGGAGAAGGTGGCAGG + Intronic
1020122525 7:5513230-5513252 GGCTCCAGGGAGAAGTGGGCTGG + Intronic
1020279600 7:6643529-6643551 GACTGCATGAAGAGGGGGACTGG + Intronic
1022283786 7:28935780-28935802 GACTGCCAGAAGCAGGGTGCAGG - Intergenic
1022903564 7:34834241-34834263 AACAGCAAGTATAAGGGGGCAGG + Intronic
1023342419 7:39235488-39235510 GACTGGCAGGAGAAGGGGCAGGG - Intronic
1023940563 7:44766253-44766275 GACTGGTAGGAGATGGGGGGTGG - Exonic
1024570514 7:50719246-50719268 GACTGCAAGGAGGAAGGGCCAGG + Intronic
1024875628 7:54019959-54019981 GAAGGCAAGGGGGAGGGGGCGGG - Intergenic
1025481073 7:60983555-60983577 AACTGCAAGGAGAAAGAGGATGG - Intergenic
1027263148 7:76479228-76479250 GACTGCAAGGAGAAGGTCTCGGG + Intronic
1027314532 7:76977333-76977355 GACTGCAAGGAGAAGGTCTCGGG + Intergenic
1031051779 7:116952918-116952940 GACAGCTAGGAGAAGGGAGGAGG - Intergenic
1031837537 7:126696381-126696403 GCCTGTCAGGAGTAGGGGGCAGG - Intronic
1032076284 7:128837669-128837691 GTCTGCACGGTGAAGTGGGCAGG - Exonic
1033130179 7:138739330-138739352 GACTGTATGGAAAATGGGGCTGG + Intronic
1033162695 7:139011465-139011487 GACTGGAAGGAGCTGGGGGCTGG - Intergenic
1033286531 7:140046004-140046026 GACTGGAAGGAGATGGGGTGAGG + Intronic
1033449122 7:141447370-141447392 AGCAGCAAGGAGAAGGGGCCTGG + Intronic
1034553856 7:151837618-151837640 GACTGCAGGGAGCAGGGGAGAGG + Intronic
1035310865 7:157967827-157967849 GAATCCAGGGAGAAGGGGTCTGG + Intronic
1035635430 8:1140362-1140384 GACTGCAAAGAGGACGGAGCAGG - Intergenic
1035787647 8:2274907-2274929 GACTCCAAGGGGAAGGAGGGAGG - Intergenic
1035805163 8:2446809-2446831 GACTCCAAGGGGAAGGAGGGAGG + Intergenic
1036446891 8:8829282-8829304 AGCTGCACGGAGAAGGGTGCTGG - Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037608695 8:20458633-20458655 GACTGGAAGGTGATGGGGGCAGG - Intergenic
1038147570 8:24913139-24913161 GAATGCAAGGGGAAGGAGGGAGG + Exonic
1038310545 8:26443118-26443140 CACTGAAAGGAGAAAGGGGGAGG + Intronic
1038427039 8:27470327-27470349 GGCTGCAGGGAGAAGGGCTCTGG + Intronic
1039310136 8:36308754-36308776 GACTGTAATGAGAAGGTGGTGGG + Intergenic
1041401303 8:57448224-57448246 GTTTGCAAGGAGAAGGAGCCTGG - Intergenic
1043520010 8:81034867-81034889 GGCTGCCAGGAGAAGGGAGCGGG + Intronic
1044632531 8:94293182-94293204 GACAGCAGGGAGCAGGGAGCAGG + Intergenic
1045252890 8:100496128-100496150 GAGTGGAAGGAGAAGGGGCTGGG + Intergenic
1046395394 8:113633344-113633366 GTCTGCAAGGAGACGTGGCCAGG - Intergenic
1047118254 8:121869828-121869850 GACAGCAATGAAAAGTGGGCTGG - Intergenic
1047696966 8:127413433-127413455 TACAGCTAGGTGAAGGGGGCAGG - Intergenic
1048308916 8:133303290-133303312 GACTTCAAGGAGGGAGGGGCAGG - Intergenic
1048628166 8:136210019-136210041 TGGTGCAAGGAGAAGGGGGTTGG - Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049888325 9:43762-43784 GACTGCAAGGAGGTGTGGGGAGG - Intergenic
1050562222 9:6845708-6845730 GCATGAAAGGAGAAAGGGGCCGG + Intronic
1050672225 9:8010467-8010489 GGCTGAAAGGACAAGGGGGACGG + Intergenic
1051131009 9:13861056-13861078 GTTTGCAATGAGAAGGAGGCAGG - Intergenic
1051157421 9:14165699-14165721 GGCTGCAAAGAGGAGGAGGCTGG - Intronic
1052014171 9:23445704-23445726 GACTTCAAAGGGAAGAGGGCCGG - Intergenic
1053259247 9:36647445-36647467 GGCTTCATGGAGAAGGTGGCTGG - Intronic
1053740208 9:41128709-41128731 GGGTGCGAGGAGGAGGGGGCTGG - Intergenic
1054688140 9:68302604-68302626 GGGTGCGAGGAGGAGGGGGCTGG + Intergenic
1056461769 9:86815833-86815855 GGCTGCCAGGAGGAGAGGGCTGG + Intergenic
1057307030 9:93918424-93918446 GACTGCATGGGGATGGGGGATGG - Intergenic
1057314864 9:93961528-93961550 GACTGGAAGGGAGAGGGGGCTGG + Intergenic
1057555069 9:96081575-96081597 GAGAGGAAGGATAAGGGGGCAGG - Intergenic
1058392687 9:104513835-104513857 GACTGCATGGAGTTGGGGGTTGG + Intergenic
1060185714 9:121562951-121562973 GGCTACAAGGGGAAGGTGGCCGG - Intergenic
1060234625 9:121853613-121853635 GACTGCAGGCAGCTGGGGGCCGG + Intronic
1061000319 9:127899087-127899109 GGCTCCAGGGAGAAGGGGGAGGG + Intronic
1061128129 9:128689519-128689541 GAAGGGAAGGCGAAGGGGGCGGG - Intronic
1061819931 9:133221568-133221590 GACTTCAGGGAGAATGGGGCGGG + Intergenic
1061901097 9:133672503-133672525 GTCTGCGAGGAGCAGGGGGAAGG + Intronic
1062240723 9:135536377-135536399 GACTGCAAGGAGAAGGGGGCGGG - Intergenic
1062711222 9:137976150-137976172 GACAGTGAGGAGCAGGGGGCTGG + Intronic
1203637152 Un_KI270750v1:123811-123833 GATTGACAGGAGAAGGTGGCAGG + Intergenic
1185893421 X:3839041-3839063 GACTTCAAGGAGAAGGGAGACGG + Intronic
1185898538 X:3877465-3877487 GACTTCAAGGAGAAGGGAGGCGG + Intergenic
1185903653 X:3915894-3915916 GACTTCAAGGAGAAGGGAGGCGG + Intergenic
1186853937 X:13607869-13607891 GACTGCCAGGAGAAAGGGTCAGG - Intronic
1186877518 X:13830928-13830950 CACTGCAAGGGAAAGGGGGCAGG + Intronic
1187055702 X:15739540-15739562 GGCTCCAGGGAGAAGAGGGCAGG - Intronic
1187412260 X:19061834-19061856 GGCAGCAGGGAGAAGGGGCCTGG + Intronic
1188894219 X:35646240-35646262 GTCTTCAAGGAGAAGGGAGAAGG + Intergenic
1190842117 X:54154903-54154925 GACAGAAAAGAGAAGGGGCCGGG + Intronic
1192207318 X:69105094-69105116 GAAGGCAAGGTGAAGGGGCCGGG + Intergenic
1194741192 X:97576104-97576126 GACTGTAAGGAAAAGGGGGTTGG + Intronic
1197707424 X:129644357-129644379 GAAAGCAAGGAGAAGGGAGTGGG - Intergenic
1198125517 X:133639950-133639972 GACTGGCAGGAGTTGGGGGCCGG - Intronic
1199698476 X:150360438-150360460 GACTGCAAGGAGAGGGTTGAAGG + Intergenic
1200129718 X:153834586-153834608 GGCTCCCAGGAGAAGGGAGCTGG - Intergenic
1201252092 Y:12069474-12069496 GTCTGCATGGAGATGGAGGCAGG + Intergenic