ID: 1062242659

View in Genome Browser
Species Human (GRCh38)
Location 9:135548504-135548526
Sequence GGGGAGAGGAGGCCTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1255
Summary {0: 1, 1: 0, 2: 13, 3: 108, 4: 1133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062242659_1062242663 -8 Left 1062242659 9:135548504-135548526 CCATTCTCAGGCCTCCTCTCCCC 0: 1
1: 0
2: 13
3: 108
4: 1133
Right 1062242663 9:135548519-135548541 CTCTCCCCCTTGCCTGGTGCTGG 0: 1
1: 0
2: 4
3: 36
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062242659 Original CRISPR GGGGAGAGGAGGCCTGAGAA TGG (reversed) Intronic
900227502 1:1540053-1540075 GGGGAGCGTAGGCCGGAGAGAGG + Intronic
900323418 1:2095898-2095920 GGGGAGAGGAGGGGAGAGGAGGG - Intronic
900615627 1:3564532-3564554 GGGGAGAGGAGGCCAGTGCTGGG - Intronic
900714140 1:4133251-4133273 GGGAAGAGGAGGCCTGGGGCAGG + Intergenic
900780405 1:4614171-4614193 GGGGAGAGGCGGCGTGACCACGG + Intergenic
900830142 1:4959937-4959959 GGGGAGGGGAGGACAGAGGAAGG + Intergenic
901206642 1:7501320-7501342 GAGGAAGGGAGGCCTGAGAACGG + Intronic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
901835886 1:11923811-11923833 GAGGAGAAGTGGCCTGAGACTGG - Intronic
902178557 1:14670099-14670121 GGGGAGGGGAGGGCTGGGGAGGG - Intronic
902246223 1:15122602-15122624 GGGGAGAGGAAGCCTGTGTTGGG - Intergenic
902255851 1:15188190-15188212 GGGGAGAGGCTGCCTGAGGAGGG - Intronic
902376485 1:16032372-16032394 AGGGAGAGGTGGTCTGAGAGAGG + Intronic
902384266 1:16067482-16067504 GGAGGGAGCAGGTCTGAGAAGGG - Intronic
902606909 1:17573935-17573957 GGGGAGGGGAGCTCTGAGAAGGG - Intronic
902633423 1:17719417-17719439 GGAGAGAGGAAGGCTGAGGAGGG + Intergenic
902671503 1:17977652-17977674 CGGAAGAGGAAGCCTGAGCAGGG + Intergenic
902720438 1:18300786-18300808 GGGGGTAGGAGGCCTGGGATTGG - Intronic
902817141 1:18922860-18922882 GGTGAGAGGTGGCCTGGGACCGG - Intronic
903141861 1:21344145-21344167 GGTGAGAAGAGGCCTTGGAAGGG + Intronic
903230084 1:21916398-21916420 GGGAGGAGGAGGCAGGAGAATGG + Intronic
903282658 1:22258827-22258849 GGGGAGAAGAGGAGGGAGAAAGG - Intergenic
903295903 1:22342932-22342954 GGAGAGAGGAGGAGGGAGAAGGG + Intergenic
903297082 1:22350738-22350760 GGGGAGGGGAGGCCAGAGTGGGG + Intergenic
903447959 1:23434447-23434469 GGGGAAAGGAGGGAAGAGAATGG + Intronic
903522233 1:23959588-23959610 GCGGAGAGGCCGCCGGAGAAAGG + Intronic
903604810 1:24567862-24567884 TGGGAGAGGAGGCAGGAGAGAGG + Intronic
904212929 1:28897612-28897634 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
904212933 1:28897622-28897644 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
904212937 1:28897632-28897654 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
904626681 1:31810067-31810089 GGGGAGGGGAGGGCAGAGGAGGG - Intronic
904719767 1:32499279-32499301 GGGGACAGGTCCCCTGAGAAGGG + Intronic
904800072 1:33086364-33086386 GGGGAGAGGATGGCTGAGCTGGG + Intronic
904974856 1:34448063-34448085 GGGGATAGGAGGAATGAGGATGG - Intergenic
905336738 1:37249670-37249692 GGGGAGAGGAGCATTGGGAAGGG - Intergenic
905593739 1:39187951-39187973 GGGGAGAGGAGGGGAGGGAAGGG - Intronic
905593744 1:39187961-39187983 GGGGAGAGGAGGGGAGAGGAGGG - Intronic
905655712 1:39684733-39684755 GGGGAGAGGAGGCCCCATTATGG - Intronic
906117837 1:43367649-43367671 GGGGAGAGGAGGAGGGAGAGAGG + Exonic
906534852 1:46545733-46545755 GGGGAGAGCATGGCTGAGAGGGG + Intronic
906710178 1:47923490-47923512 TGGGAAAGGATGGCTGAGAAAGG + Intronic
907384317 1:54116111-54116133 GAGGAGAGGTGGCCTGACCAAGG - Intergenic
907447284 1:54516632-54516654 AGGGAGAGGAGGCCTGAGAGAGG + Intergenic
907479721 1:54737060-54737082 GGGGCCAGCAGGCCTGAGCAGGG - Intronic
908567137 1:65368753-65368775 GGGGAGGGGAGGGAAGAGAAGGG - Intronic
909238258 1:73180491-73180513 GCAGAGAGGAGGCCTGGAAAGGG + Intergenic
909586812 1:77299530-77299552 TGGGAGAGGAAACCTAAGAAGGG - Intronic
910564822 1:88631560-88631582 GGGGAGGGGAGGGGAGAGAAGGG + Intergenic
910637033 1:89420161-89420183 GGAGAGAGGAGACCAGAGATGGG - Intergenic
910789691 1:91038439-91038461 GGAGAGAAGAGGCCTAAGTATGG - Intergenic
911152832 1:94611418-94611440 GGGGAGAGCTGGTCTGAGAATGG + Intergenic
912425571 1:109586539-109586561 GGGGAGAGGAGGTAGGAGGAAGG - Intronic
912625211 1:111200513-111200535 GGTGACAGTAAGCCTGAGAAAGG + Exonic
912841550 1:113043693-113043715 GGGCTGAGAAGGGCTGAGAAGGG - Intergenic
913680302 1:121183975-121183997 GGGAAGAGGAGGCGTGGGTAGGG - Exonic
914032137 1:143971626-143971648 GGGAAGAGGAGGCGTGGGTAGGG - Exonic
914157308 1:145096341-145096363 GGGAAGAGGAGGCGTGGGTAGGG + Exonic
914801423 1:150965469-150965491 AGGGGGAAGAGGCCAGAGAAAGG + Exonic
914826683 1:151142540-151142562 GGGGAAAGGCGGCCTGAGTATGG + Exonic
914827736 1:151147242-151147264 GGGGGCTGGAGGCCTGGGAAAGG + Intergenic
914967868 1:152277485-152277507 GGGTAGAGGAAGCATCAGAAAGG + Intergenic
915084193 1:153374019-153374041 AGGGATAAGAGGCCTAAGAAAGG - Intronic
915101467 1:153503864-153503886 TGGGAGATGAGGCCTGCAAAAGG + Intergenic
915148249 1:153808354-153808376 GGGGAGTAGAGGCCAGAGTAGGG + Exonic
915482966 1:156199731-156199753 CAGGAGATGAGGGCTGAGAATGG + Intronic
915518884 1:156429964-156429986 GTTGAGGGGAGGCCTGGGAAGGG - Intronic
915841336 1:159215881-159215903 GGGCAGAGGGAGCCTGGGAAAGG - Intergenic
915947652 1:160165656-160165678 GGGAAGATGAGGCAGGAGAATGG + Intronic
915972649 1:160365452-160365474 GGGGAAAGGAGGCTTGAGGAGGG - Intergenic
916412333 1:164559013-164559035 GGGGAGAGGAGGAGGGAGGAGGG - Intronic
916562147 1:165942207-165942229 GCGGTAAGCAGGCCTGAGAATGG - Intergenic
916588099 1:166165851-166165873 TGGGAGAGGAGGCGGGAGGAAGG + Intronic
916704143 1:167329415-167329437 GGGGAGAGTTGGACTGAGCAGGG + Intronic
916724528 1:167510797-167510819 GTGGGGAGGAGGGCTCAGAATGG - Intronic
917513023 1:175683686-175683708 GGGGAGGGGAGGGCAGGGAAAGG + Intronic
917535548 1:175872012-175872034 AGGGGGAGGAGGACAGAGAAAGG - Intergenic
917652270 1:177089654-177089676 TGCGGGAGGAGGCCTTAGAATGG - Intronic
917683611 1:177393519-177393541 AGGGAAAGGGAGCCTGAGAAGGG + Intergenic
917735975 1:177920875-177920897 GGGGAGAGGTGGTGGGAGAAAGG - Intergenic
917846652 1:179025918-179025940 GGCGAGAGGTGGCCTGGGAATGG + Exonic
917905829 1:179586607-179586629 GGGTGGAGGAGGCTCGAGAAAGG - Intergenic
918282805 1:183023117-183023139 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
919288512 1:195598345-195598367 GAGGAGAGGAGGGAAGAGAAGGG - Intergenic
919805242 1:201377578-201377600 GGGAAGAGGAGAGCAGAGAATGG - Intronic
919854296 1:201695139-201695161 GGGGCCAAGAGGCCTGAGCATGG - Intronic
920364538 1:205441082-205441104 AGGGAGAGGGGGCAGGAGAAAGG + Intronic
920369013 1:205465713-205465735 GGGGAGAGAGGGTCAGAGAAAGG - Intergenic
920467614 1:206202510-206202532 GGGAAGAGGAGGCGTGGGTAGGG - Exonic
920500410 1:206481707-206481729 GGTAAGAGGAGACCTGAGATGGG + Intronic
921353035 1:214256939-214256961 ATGGAGTGGAGGACTGAGAAGGG + Intergenic
921377929 1:214493157-214493179 GGTGCGAGGAAGCCTCAGAACGG + Intronic
922125039 1:222713224-222713246 CGGGAGAGGTGGCCAGACAACGG - Intronic
922160970 1:223078983-223079005 GGGGAGAAGAGGCCAGAGGGAGG + Intergenic
922178870 1:223217999-223218021 GGCGAGAGGAGGCAAGAGAGAGG - Intergenic
922471943 1:225882276-225882298 GGGGACAGGGGGCGTGAGGAGGG - Intronic
922781505 1:228256570-228256592 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
922781895 1:228259419-228259441 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
922782467 1:228264034-228264056 GGGGAGAGAAGGCCTGGGCAGGG - Intronic
922791096 1:228311538-228311560 GGGGTGAGGAAGCGTGAGTAGGG - Intronic
922864637 1:228849033-228849055 GGGGTGTGGAGGCCTGAGGTGGG + Intergenic
923388734 1:233492342-233492364 GGGGTAAGGAGGCCAGAGAGGGG - Intergenic
923738319 1:236633040-236633062 GGGGAGGGGAGGCCAGGGGAGGG - Intergenic
923779167 1:237006972-237006994 GTGGAGTGGAGACCTGAGTATGG - Intergenic
923981427 1:239328362-239328384 GAGGACAGCAGGCTTGAGAAAGG - Intergenic
924748122 1:246858062-246858084 GGGGGGCGGAGGCAGGAGAATGG - Intronic
1062824443 10:557736-557758 GGGGAGAGGATGGGTGGGAAGGG + Intronic
1062947872 10:1474697-1474719 GGGGAGAGAATGCGTGGGAATGG + Intronic
1062998677 10:1892875-1892897 GGGGACAGGAGGCCAGTGATGGG - Intergenic
1063464932 10:6236918-6236940 GGGGAGAGGAGGGCTGGGGCCGG + Intergenic
1063967722 10:11359799-11359821 GGGGAGAGGAGGGAGAAGAAGGG + Intergenic
1064266246 10:13827817-13827839 TGGGAGAGGAGGAGGGAGAAGGG + Intronic
1064272681 10:13879722-13879744 AGGGAGAGGAGGAGGGAGAAGGG - Intronic
1065333554 10:24630594-24630616 GGGAAGCTGAGGCATGAGAATGG - Intronic
1065708753 10:28495284-28495306 AGGGAGAGGAGGGAGGAGAAGGG + Intergenic
1065866576 10:29919969-29919991 GAGAAGAGGAGGACAGAGAAAGG - Intergenic
1066443108 10:35457683-35457705 GGGGAGCTGAGGCAGGAGAATGG - Intronic
1066447060 10:35492939-35492961 GGGGAGAGCTGGCCTGAGGGTGG - Intronic
1066569294 10:36753975-36753997 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
1067142469 10:43668620-43668642 TGGGAGAGGAAGCCTGATACAGG - Intergenic
1067576559 10:47412407-47412429 GGGCAGAGGAGGCATCTGAATGG - Intergenic
1067606424 10:47667840-47667862 GGGAAGCTGAGGCATGAGAATGG - Intergenic
1068457674 10:57279690-57279712 GGGGATAGGAGGCAAGAGGAGGG - Intergenic
1068669153 10:59707267-59707289 GGGGAGAGGAGGGAAGGGAAGGG + Intronic
1069286663 10:66723123-66723145 AGGGAGAGGAGGGGAGAGAAAGG + Intronic
1069381772 10:67849265-67849287 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1069570191 10:69490051-69490073 AGAGAGAGGAGGCCTGGGATGGG - Intronic
1069615984 10:69806388-69806410 GAGGACAGGAGGCCTGAGAGGGG + Intronic
1069706175 10:70460182-70460204 GGGGAGGGGAGGCCTGGGGCAGG - Intergenic
1069824150 10:71245103-71245125 GGGGAGAGGAGGTCAGAGAAGGG - Intronic
1069950344 10:72014377-72014399 AGGCAGAGGAGGGCTGAGCACGG + Intergenic
1070331253 10:75418850-75418872 TGGGAAAGGATGGCTGAGAAGGG - Intergenic
1070510112 10:77153237-77153259 GGGAAAAGAAGGCCTGAGACTGG + Intronic
1070659334 10:78293523-78293545 GGGGACAGGAGCCTTGAGACTGG - Intergenic
1070757940 10:79005118-79005140 GTGGAGATGTGTCCTGAGAAAGG + Intergenic
1070804741 10:79264441-79264463 GGGGAGAGGTGCCCTGAGAAGGG - Intronic
1070829528 10:79409925-79409947 TGGGGGAGGAGGCGGGAGAAGGG + Intronic
1071270713 10:84004480-84004502 AGAGAGAGTAGGGCTGAGAAGGG + Intergenic
1071520758 10:86330281-86330303 GGGGAGAGGAGCCCCAAGGAAGG - Intronic
1071621985 10:87129193-87129215 GGGAAGCTGAGGCATGAGAATGG - Intronic
1071789830 10:88941975-88941997 GGGCAGAGGAGGCCAAAGTAAGG + Intronic
1072270129 10:93768306-93768328 GGAGAGAGGAAGCCTGAGCCTGG + Intronic
1072749919 10:97970545-97970567 GGGGAGAGCTGGCCTGAGGCAGG - Intronic
1073364439 10:102926818-102926840 GGGAAGCTGAGGCATGAGAATGG - Intronic
1074356100 10:112784824-112784846 GGGGAAAGCATGCCTAAGAAAGG + Intronic
1074524673 10:114253253-114253275 GGGGAGAGGAGGGGGGAGACGGG - Intronic
1074853687 10:117458024-117458046 GGGAAGAGGAGGCCAGAGGGCGG - Intergenic
1074985914 10:118659213-118659235 GGGTAGAGGAAGCCACAGAAAGG - Intergenic
1074989219 10:118687679-118687701 TGGGAGAGTAGGCTGGAGAATGG - Intronic
1075031800 10:119029308-119029330 GGGGAGAGAAGGGCCGGGAAGGG - Intergenic
1075084790 10:119407341-119407363 AAGGAGAGGAGGCCTCAAAAGGG + Intronic
1075310140 10:121407010-121407032 GGGTAGAGGTGGCGTGGGAAGGG - Intergenic
1075340739 10:121645215-121645237 GGGAAGGGGAGCCCTGAGAAAGG + Intergenic
1075382189 10:122028766-122028788 GGGGAGCGGAGGCAAGGGAAGGG - Intronic
1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG + Intergenic
1075689879 10:124387651-124387673 GGGGAGGTGGGGCCTGAGGAGGG - Intergenic
1075905147 10:126074852-126074874 GTGGAAAGGAGCCCTGAGAAAGG - Intronic
1076214338 10:128680721-128680743 GGTGAGAGGGAGGCTGAGAAGGG + Intergenic
1076695955 10:132247520-132247542 GGGGAGAGGACGCCTGTGCTGGG + Intronic
1076732077 10:132444127-132444149 GGGGTGGGGAGCCCTGAGGAAGG - Intergenic
1076768758 10:132651555-132651577 GGGGACAGAAGGCCAGAGATGGG - Intronic
1076856201 10:133116577-133116599 GGGGAGAGGACGCCTGTGGGTGG - Intronic
1076872923 10:133202408-133202430 AGGGAGAGGAGGTCTTAGACCGG + Intronic
1077286416 11:1767942-1767964 GGGGAGAGGAGGCAGGAGGTGGG + Intergenic
1077481083 11:2814976-2814998 GTGCAGAGCAGGCCTCAGAAGGG - Intronic
1077921938 11:6647822-6647844 GGGCAAGGGAGGCCTGAAAAAGG + Intronic
1077985355 11:7346216-7346238 GGGAAGAGGAGGACTGAAATTGG + Intronic
1078340755 11:10496648-10496670 TGGGAGAGGAGGACAGAGGAGGG + Intronic
1078352689 11:10607606-10607628 GGGGCGGGGAGGCCTGGGAGGGG + Intronic
1079253466 11:18805658-18805680 GGGGAAAGGAGGACAGGGAAGGG + Intergenic
1079861748 11:25681151-25681173 GGGGAGAGCAGGGGTGGGAAGGG + Intergenic
1079934805 11:26604087-26604109 GGGGAGGGGAGGATTGAGAGAGG - Intronic
1079960551 11:26918223-26918245 GGGGAGAGGAGACTAGAGGAAGG + Intergenic
1080719751 11:34837559-34837581 TGGGAGAAGAGGCTGGAGAATGG - Intergenic
1081072492 11:38628821-38628843 CTGGAGAGCAGGCATGAGAATGG + Intergenic
1081201225 11:40218342-40218364 GGCAAGAAGAGGCCTAAGAAGGG + Intronic
1081481580 11:43494541-43494563 GGAGGGAGGGGGGCTGAGAAGGG + Exonic
1081484417 11:43516560-43516582 GGGAAGAGGTGTCCTAAGAAAGG - Intergenic
1081611587 11:44566206-44566228 GGGAAGAGGAGGCCAAAGCAGGG + Intronic
1081794573 11:45810746-45810768 GGGGAGAGGAGGAGTGGGGAAGG - Intronic
1081856787 11:46308931-46308953 GGGAAGAGGAGACTTCAGAAAGG + Intronic
1081870634 11:46381293-46381315 GAGAAGCTGAGGCCTGAGAACGG + Intronic
1082043333 11:47705252-47705274 GGGGAGAGAAGGCATGAGATGGG + Intronic
1082223900 11:49677698-49677720 GGGGAGAGGAGGGAAGAGGAGGG - Intergenic
1082223903 11:49677708-49677730 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1082764742 11:57158062-57158084 GGGGAGACAAATCCTGAGAAGGG - Intergenic
1082768033 11:57184030-57184052 AGGGAGAGGAGGACTGAGTGGGG + Intronic
1082976832 11:59080951-59080973 TGGGAGAGGAGCCCTCAGATGGG + Intergenic
1083143641 11:60741225-60741247 GGAGAAATGAGGCCTGAGAGAGG + Intronic
1083188767 11:61034766-61034788 GGGGGCAGGGGGCCTGAGAGGGG - Intergenic
1083536068 11:63467662-63467684 CAGGAGATGAGGCCTGATAAGGG - Intronic
1083653703 11:64219219-64219241 GGGGAGAGGAGGCTGGAGGCTGG - Intronic
1083778037 11:64903664-64903686 GGGGGGAACAGGGCTGAGAAGGG + Intronic
1083782126 11:64924149-64924171 GGGGACTGCAGGCCTGAGGATGG + Intronic
1083859610 11:65412811-65412833 GGAAAGAAGAGGCCTGGGAAGGG + Exonic
1084064716 11:66697217-66697239 GGGGGGTGGAGCCATGAGAAGGG - Intronic
1084118018 11:67053149-67053171 GGGAAACTGAGGCCTGAGAAGGG - Intergenic
1084285544 11:68128451-68128473 GGGAGGAGGGGGCCTCAGAAGGG + Intergenic
1084374192 11:68764674-68764696 GAGGAGAGGAGGCCCCTGAAAGG + Intronic
1084409463 11:68997956-68997978 GGGGAGATCCTGCCTGAGAATGG + Intergenic
1084928675 11:72535923-72535945 GGGGAGGGGAGGGGTGGGAAGGG + Intergenic
1085050613 11:73378177-73378199 CGGGAGAAGGGGCCTCAGAAGGG - Intronic
1085226847 11:74929334-74929356 GGGGAGATGAGGCCTGAGCCAGG - Intronic
1085287358 11:75372279-75372301 GGAGTGAGGAGGCAGGAGAAGGG - Intergenic
1086148398 11:83580869-83580891 GGGGAGAGGAGGGGAGAGAAGGG - Intronic
1086625139 11:88941479-88941501 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
1086625143 11:88941489-88941511 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
1087291165 11:96322269-96322291 GAGGGGAGGAAGCCTGAAAATGG + Intronic
1087501446 11:98959551-98959573 GGGAAGTGGAGGCAGGAGAATGG + Intergenic
1087550601 11:99642735-99642757 GGGGAGAAGAGGATGGAGAAAGG - Intronic
1088326559 11:108606705-108606727 GAGGAGAGGAGGCTTGAGGGAGG - Intergenic
1088630620 11:111770818-111770840 GTGGAGAGGAGACCTGAGGGAGG - Intergenic
1088711342 11:112511640-112511662 GAGGATAGGAGTCCAGAGAAGGG - Intergenic
1089078751 11:115759695-115759717 GGGGAGGCGAGGCTGGAGAAGGG - Intergenic
1089270703 11:117299815-117299837 TGGGAGCTGAGTCCTGAGAATGG - Intronic
1089326999 11:117664107-117664129 TGGGAGAGGAGGCCAGGGGAGGG + Intronic
1089562529 11:119351484-119351506 GGGGAGGGGAGGACAGAGGAGGG - Intergenic
1089587749 11:119520837-119520859 GGGGAAAGGGGGCCTGGGGAGGG + Intergenic
1089655612 11:119944613-119944635 GGGGAGAGGAGGAGAGAGGAAGG + Intergenic
1090004470 11:122989461-122989483 GAGGACAGCAGGCCTTAGAAAGG - Intergenic
1090269216 11:125374211-125374233 TGGGTGAGGTGGCCTGAGAATGG + Intronic
1090426196 11:126608533-126608555 GGGGAGAGGAGGGAAGAGGAGGG - Intronic
1091041242 11:132283945-132283967 GAGGAGAGGAGGCCAGGAAAAGG - Intronic
1091211418 11:133864442-133864464 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1091280858 11:134380754-134380776 GGGGAGAGGAGGAATGAGTGAGG + Intronic
1091428543 12:412838-412860 TGAGAGAGGAGGGCTAAGAAGGG - Intronic
1091775974 12:3185199-3185221 GGGGAGACGGGGCGGGAGAAGGG + Intronic
1092092122 12:5812100-5812122 GGGGAGGCGAGGCCAGGGAAGGG + Intronic
1092284921 12:7123141-7123163 GTGGAGAGGAGGCCAGAGGCTGG + Intergenic
1092386422 12:8038862-8038884 GGGAGGAGGAGGGCGGAGAAGGG + Intronic
1093256416 12:16873551-16873573 GGGGAGTGGGGGCCTGGGGAGGG - Intergenic
1093511188 12:19930309-19930331 GTGGAGAAGAGGCATAAGAAAGG - Intergenic
1094089287 12:26630056-26630078 TGGGAAAAGAGGACTGAGAAAGG + Intronic
1094772664 12:33683623-33683645 GGGGAGCTGAGGCAGGAGAATGG - Intergenic
1095275883 12:40282083-40282105 GGGGAGGGGAGGGAAGAGAAGGG - Intronic
1095275891 12:40282103-40282125 GGGGAGGGGAGGGAAGAGAAGGG - Intronic
1095510778 12:42949573-42949595 GGGGAGAGGAGGCATGAAACTGG - Intergenic
1095675446 12:44912072-44912094 GGGGAGGGTAGTACTGAGAATGG + Intronic
1095923639 12:47556670-47556692 GTGGAGAGGGGGCCTGAAAGAGG - Intergenic
1096230880 12:49896162-49896184 CGGGAGAGGAGGCCTCTGCAGGG - Intronic
1096313775 12:50545366-50545388 GGGGAGAGGAGGGGAGAGGAAGG - Intronic
1096782853 12:54000885-54000907 AGGGGCAGGAGGTCTGAGAATGG + Intronic
1097195909 12:57242458-57242480 GGGAAGAGGAGGCCTGGGACGGG - Intergenic
1097249330 12:57623919-57623941 GAGCAGAGGAGGCATGAGCATGG + Intronic
1097276953 12:57820255-57820277 GGGAAGAGGAGGCCAGAGGTCGG - Exonic
1097848551 12:64390075-64390097 GGGTAGGGGAGGCGGGAGAATGG + Intronic
1098256149 12:68617866-68617888 GGGGAGCTGAGGCTGGAGAATGG - Intronic
1100614911 12:96223483-96223505 GGAGAGAGGGGGCTTCAGAATGG - Intronic
1100670754 12:96810043-96810065 GGAGAGAGGAGGCAAGGGAAAGG + Intronic
1101157370 12:101940544-101940566 GGGGAGAGGAGGGAAGGGAAAGG + Intronic
1101285516 12:103307836-103307858 GGGGAGAGGGGTGCTGTGAAAGG + Intronic
1101344961 12:103878500-103878522 GGGAAGAAGAGGCTTGAGGAGGG - Intergenic
1101910964 12:108859865-108859887 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
1101910968 12:108859875-108859897 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
1101910999 12:108859940-108859962 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
1101963232 12:109265357-109265379 GGGCAGAGGATGCCTCAGAGAGG - Intronic
1102001551 12:109560948-109560970 AGGGAGAGGAGGACGGAGATGGG - Intronic
1102218530 12:111178939-111178961 GGGGAAAGCAGGGCTGAGAGAGG + Intronic
1102318705 12:111912280-111912302 GGGGAGAGGAACCAGGAGAAAGG - Intergenic
1102559798 12:113754149-113754171 GGGGAGAGGAGGGGAGAGAAGGG + Intergenic
1103608228 12:122104294-122104316 AAGGAGAGGATGCCTGGGAAGGG - Intronic
1104049414 12:125186036-125186058 GGGGTGAGGAGGCCAGCGGAGGG - Intergenic
1104498963 12:129266505-129266527 GGGGAGAGGAGATAAGAGAAAGG - Intronic
1104577673 12:129982793-129982815 GGGGAGATGGAGGCTGAGAAGGG - Intergenic
1104725077 12:131070929-131070951 GGTCAGAGTGGGCCTGAGAAGGG + Intronic
1104801976 12:131560234-131560256 GGGGTTAGTGGGCCTGAGAAGGG - Intergenic
1104895630 12:132162332-132162354 GGGGAGAGGAGACAAGAGAGGGG - Intergenic
1104941122 12:132395845-132395867 GAGCAGAGGAAGCCTGAGAAGGG + Intergenic
1104991449 12:132625957-132625979 GGTGTGGGGAGGCCTGGGAAGGG + Intronic
1105941642 13:25152956-25152978 GGCAAGAGGAAGCGTGAGAAAGG + Intergenic
1106136363 13:26976598-26976620 GTGCAGAGGAGGCCATAGAAGGG + Intergenic
1106231649 13:27825599-27825621 GAGGAGAGGTGGCCTGAGGCTGG - Intergenic
1106243125 13:27925638-27925660 AGGAAGAGGAGGGATGAGAAGGG - Exonic
1106444125 13:29809236-29809258 GGGGAGAGGGAGCTTGAGAAAGG + Intronic
1106551171 13:30772353-30772375 GGGGAGAGGAGTCAGGGGAAAGG + Intergenic
1106581958 13:31026509-31026531 AGGGAGTGGATGCCTCAGAAGGG - Intergenic
1106759920 13:32858301-32858323 GGGGAGAGGTGGCAAGACAAGGG + Intergenic
1106916454 13:34520803-34520825 GGCTAGAGGAGGCCAGAGAGTGG - Intergenic
1107525723 13:41229472-41229494 GGGGAGAGGAGGATAGAGAGAGG - Intronic
1107585406 13:41841678-41841700 CGGGAGGGGAGGCAGGAGAATGG + Intronic
1107853495 13:44592389-44592411 GCGGAGAGGAGGCCCTGGAAAGG - Intergenic
1107924648 13:45246931-45246953 GGGAAGATGAGGCAGGAGAATGG + Intronic
1107987604 13:45788699-45788721 AGGGAGCAGAGGCCAGAGAAAGG - Intronic
1108357782 13:49642795-49642817 GGGAAGCTGAGGCCAGAGAATGG + Intergenic
1109194987 13:59368841-59368863 GAGCAGAGGAGGGCAGAGAAAGG - Intergenic
1110277738 13:73658954-73658976 GGGGGCTGGAGGTCTGAGAAGGG + Intergenic
1110737688 13:78957001-78957023 GGGGAGAGAAGGTCTGAGGAAGG + Intergenic
1111450633 13:88410274-88410296 TGGGAGAGTGGGCCTGAGAAAGG - Intergenic
1111504825 13:89174157-89174179 GGGGAGGGGAGGGGAGAGAAGGG - Intergenic
1112326838 13:98447269-98447291 GGGGCGAGGAGGGCTCAGCAGGG - Intronic
1112435405 13:99388451-99388473 GGAGAGAGGAGGGCTGGGGATGG + Intergenic
1112609720 13:100944662-100944684 GGGAAGATGAGGGCTGAAAAAGG + Intergenic
1113092176 13:106627708-106627730 GGTGAGCGTTGGCCTGAGAAAGG + Intergenic
1113102173 13:106732668-106732690 TGGGACAGGAGGCAGGAGAAAGG + Intergenic
1113571669 13:111362374-111362396 GAGGAGAGGAGGCCACAGCATGG + Intergenic
1113655617 13:112066707-112066729 GGGGGGAGGAGGCCCGGGAGGGG - Intergenic
1113670169 13:112170801-112170823 GGTGAGAGGAGGCCTTGGGAGGG + Intergenic
1113837607 13:113338511-113338533 TGGGCGGGGAGGCCTGAGATGGG + Intronic
1114032378 14:18588289-18588311 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1114077159 14:19167315-19167337 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1114085005 14:19232249-19232271 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1114402914 14:22426426-22426448 GGGGAGAGGAGGCAGGGGGAAGG - Intergenic
1114430830 14:22658980-22659002 GGAGAGAGGAGGCAGCAGAATGG - Intergenic
1114559321 14:23579002-23579024 GGGGAGATGCAGCCTGAGAGAGG + Intergenic
1115114007 14:29857736-29857758 GGAGAAAGGAGGACTGAAAAAGG + Intronic
1115437818 14:33396080-33396102 GTGGGGAGGAAGCCTGAGAAAGG + Intronic
1115964933 14:38877402-38877424 AGGGAGAGGGAGCATGAGAAAGG - Intergenic
1115975811 14:38995769-38995791 AGGGAGAGCTTGCCTGAGAAGGG - Intergenic
1116128803 14:40826176-40826198 GGGGGGTGGAGGCCTGGGAGAGG + Intergenic
1116244545 14:42393417-42393439 GGGGAGCTGAGGCAGGAGAATGG - Intergenic
1116414780 14:44667021-44667043 CTGGAGAAGAGGCATGAGAATGG + Intergenic
1116628438 14:47297477-47297499 GGGGAGTGGAGGGGTGTGAAGGG + Intronic
1116759519 14:48993857-48993879 GTAGAGAGGAGACATGAGAAGGG + Intergenic
1117060602 14:51958646-51958668 GGGGAGAGGAGGCCATGGAGTGG - Intronic
1117066361 14:52016050-52016072 GAGGAGAGGATGCTGGAGAAAGG - Intronic
1117446191 14:55805727-55805749 GTGGAGAGGAGCCCAGAGCACGG - Intergenic
1117647112 14:57865048-57865070 GGGGGGGGGGGGTCTGAGAAGGG - Intronic
1118132158 14:62978480-62978502 GGGAAGCTGAGGCCGGAGAATGG + Intronic
1118722672 14:68605556-68605578 GGCTAGAGGAGGCCTGGGACAGG - Intronic
1118779631 14:68998579-68998601 GTGGAGAGAAGGTATGAGAAAGG + Intergenic
1119273328 14:73329452-73329474 AGAGAGAAGAGGACTGAGAAGGG - Intronic
1119330277 14:73787947-73787969 GTAGGGTGGAGGCCTGAGAAGGG + Intronic
1119573331 14:75695791-75695813 GGGGAGGGGAGGGCAGGGAAGGG - Intronic
1119673735 14:76538914-76538936 GGGGAGGGGAGGGGAGAGAAGGG - Intergenic
1119673751 14:76538954-76538976 GGGGAGGGGAGGGGAGAGAAGGG - Intergenic
1119673767 14:76538994-76539016 GGGGAGGGGAGGGGAGAGAAGGG - Intergenic
1119921561 14:78451087-78451109 GGGAAGAGGTGGCCAGAGACAGG - Intronic
1119997282 14:79267460-79267482 GGGAAGCTGAGGCATGAGAACGG - Intronic
1120010327 14:79406259-79406281 GGGGAGAGGAGGGGAGAGGATGG - Intronic
1120736971 14:88064288-88064310 GGGGAGAGGTGGGTGGAGAACGG + Intergenic
1120840738 14:89082899-89082921 GGGGTTAGCAGGGCTGAGAAGGG + Intergenic
1120882944 14:89428781-89428803 GGGGCGTGGAGGCCTGCGCAGGG - Intronic
1121156430 14:91689270-91689292 GGGGAGTAGAGGACTGGGAAGGG - Intronic
1121161995 14:91752082-91752104 GGTGAGAGGAGGCAAGAGAGAGG + Intronic
1121464884 14:94109330-94109352 GGGGAGGGGAGGGCAGGGAAGGG + Intronic
1121586959 14:95069118-95069140 GAGGAGAGGAGAGCTGAGGACGG + Intergenic
1121860236 14:97310523-97310545 GGGGAGAGGAGGGGAGAGGATGG - Intergenic
1122007765 14:98719276-98719298 GGGGAGAGGAGGCCAGGGAAGGG + Intergenic
1122523533 14:102363375-102363397 GCGCAGCGGAGGCCTGAGGAGGG - Intronic
1122695890 14:103551905-103551927 GGGGTGAGGAGGACTGAGGGAGG - Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1122986032 14:105212005-105212027 AGGGAGAGCAGGCCTGACAGAGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1202832115 14_GL000009v2_random:46413-46435 GGGGAGAGGAGGCTGGTTAATGG - Intergenic
1123434991 15:20248050-20248072 GGGAAGAGGAGGGGAGAGAACGG + Intergenic
1123987177 15:25656255-25656277 GGGGAGAGGGGGCTTGAGGAAGG + Intergenic
1124963943 15:34419394-34419416 GGGGAGAGGGGGCCTGGAGACGG - Intronic
1124980557 15:34565625-34565647 GGGGAGAGGGGGCCTGGAGACGG - Intronic
1125104039 15:35949856-35949878 TGGGAGGGGAGGCAGGAGAATGG + Intergenic
1125607584 15:40950156-40950178 GGTGGGAGGAGGTCTGAGAACGG + Intergenic
1126167538 15:45666765-45666787 GGGGAGGGGAGGGAAGAGAAGGG - Intronic
1126704835 15:51397393-51397415 GGGGAGAGAGGGACAGAGAAGGG - Intronic
1127729501 15:61786197-61786219 GGGGAGAGGAGGAGGGAGAAAGG - Intergenic
1128647069 15:69385565-69385587 GGAGAGAAGAGGCCAGAGGAGGG - Intronic
1128663697 15:69522914-69522936 AGGAAGGGGAGGCCTGAGAGAGG + Intergenic
1128743840 15:70100288-70100310 GAGGAGGGGTGGCCTGTGAAAGG + Intergenic
1128849149 15:70934014-70934036 GGGGACAGGAGGCTCTAGAAGGG - Intronic
1128894857 15:71363460-71363482 GGGCAGGGGAGACCTGAAAAGGG + Intronic
1129849914 15:78787901-78787923 TGGTAGAGGAAGCCTGAGAAAGG - Intronic
1129890966 15:79071728-79071750 GGGGAGGGAAGACCTGGGAAGGG - Intronic
1129998112 15:80024350-80024372 GGGAAGCGGAGGCAGGAGAATGG - Intergenic
1130252347 15:82307766-82307788 TGGTAGAGGAAGCCTGAGAAAGG + Intergenic
1130398009 15:83521454-83521476 GGGGAGGGGAGAGCTGGGAATGG + Intronic
1130958606 15:88644854-88644876 GGGCAGAGGAGCCCAGAGCAGGG + Intronic
1130983786 15:88831443-88831465 GGGGGGCGGAGGGCTGAGGATGG - Intronic
1131171090 15:90178774-90178796 GTAGAGAGGTGGCCAGAGAAAGG + Intronic
1131346746 15:91656452-91656474 GGGGAGAGGAGGGAAGGGAAGGG - Intergenic
1131400823 15:92124329-92124351 GGAGGGAGGGGGCCTGACAATGG + Intronic
1131460175 15:92612276-92612298 GTGGAGAGGAGGCCGCAGAAGGG - Intergenic
1131837709 15:96407978-96408000 GGGGCGAGATGCCCTGAGAAGGG + Intergenic
1132157080 15:99503140-99503162 GGGGGGAGGAGGGGTGGGAAGGG + Intergenic
1132739207 16:1402885-1402907 GGGCAGCGGAGGCAGGAGAATGG + Intronic
1133813195 16:9177253-9177275 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1134002554 16:10794083-10794105 GGGCAGAAGAGCCCTGAGACAGG + Intronic
1134081321 16:11327064-11327086 CCTGAGTGGAGGCCTGAGAAGGG - Intronic
1134122768 16:11596614-11596636 GGGGAGAGGAGGAGAGAGGAGGG + Intronic
1134151643 16:11810028-11810050 GGGGTGAGTCTGCCTGAGAATGG - Intergenic
1134241984 16:12513148-12513170 GGGGAGAGGAGTTCAGAGGAAGG - Intronic
1134592069 16:15462593-15462615 TGGGAGAGGAGGCCGGAGAGGGG + Intronic
1134631472 16:15759272-15759294 GGGGAGAGCCTGCTTGAGAATGG + Intronic
1135257696 16:20954392-20954414 GGGAAGCTGAGGCATGAGAATGG - Intronic
1135479771 16:22813420-22813442 GGGGAGAGGTGGGGTGACAATGG + Intergenic
1135533070 16:23271344-23271366 GGGAAGAGGAGGAATGAGACAGG - Intergenic
1135544544 16:23356930-23356952 GTGGGAAGGAGGCCTGAGGATGG + Intronic
1135937791 16:26795797-26795819 GGGGAGAGGAGACACAAGAAGGG + Intergenic
1135940811 16:26820103-26820125 GGGGAAAGGAGGTCAGAGAGGGG - Intergenic
1135978116 16:27124552-27124574 CTGGAGAGGAAGCCTGGGAAGGG - Intergenic
1136245777 16:28975074-28975096 GAGGGGAGGAGGCTGGAGAAAGG - Exonic
1136849622 16:33602919-33602941 GGGAAGAGGAGGGGAGAGAACGG - Intergenic
1136849645 16:33602984-33603006 GGGAAGAGGAGGGGAGAGAATGG - Intergenic
1137044716 16:35644301-35644323 GGGGAGAGAAGGGCTGAGCTGGG - Intergenic
1137256442 16:46778755-46778777 GTGGAGAGGAGGCCCTGGAAAGG - Intronic
1137532397 16:49287679-49287701 GGGAAGAGGAGGGCAGAGACTGG - Intergenic
1137592285 16:49700886-49700908 GGAGGGAGGAGGCAGGAGAAAGG + Intronic
1137592302 16:49700934-49700956 GGGCAGAGGAGGGAGGAGAAGGG + Intronic
1137615233 16:49842296-49842318 GGGGAGGGGAGGCGAGGGAAGGG + Intronic
1137617015 16:49854696-49854718 GGGGAGAGGAGGCCAGGGGAGGG + Intronic
1137691308 16:50429984-50430006 GGGCAGAGGTGGCCTGAGATGGG + Intergenic
1137783826 16:51121010-51121032 GGGGAGAGGAGGGCTGCTATTGG - Intergenic
1137947759 16:52751017-52751039 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
1138031655 16:53564008-53564030 GGGCATAGGAGGCCTGAGACAGG + Intergenic
1138252125 16:55509372-55509394 GGGGAGAGGTGGTCTGAGGGGGG + Intronic
1138451261 16:57094447-57094469 GGGAAGAAGATGGCTGAGAATGG + Intronic
1138540498 16:57684680-57684702 TGAGAGAGGGGGCCTGAGAAAGG + Intronic
1138589724 16:57993250-57993272 GGGGAACTGAGGCCTGAGAGGGG + Intergenic
1139290325 16:65852470-65852492 GGGGAGAGGAGAACTGGGTATGG - Intergenic
1139328372 16:66169060-66169082 GGGGAGAGGATGCCTGGCAGAGG - Intergenic
1139341048 16:66268010-66268032 GGGGAAAGGAGGACAGGGAATGG + Intergenic
1139405936 16:66717719-66717741 GGGAAAAGGAGGCCTGAGAGGGG + Intergenic
1139505499 16:67396323-67396345 GGGGAAAGCAGGCCCGGGAAGGG + Intronic
1139645511 16:68326743-68326765 GGGGAGAGGAGGACACAGAATGG + Intronic
1139911540 16:70400333-70400355 GGTGAGAGGAACGCTGAGAAGGG + Exonic
1139949015 16:70660287-70660309 TGGGAGAGGACCCCTGGGAAGGG + Exonic
1140026737 16:71297656-71297678 GGGGAGAGGAAGGCAGGGAAGGG - Intergenic
1140235195 16:73152795-73152817 GGGGTGAGGAGGGGAGAGAAGGG + Intergenic
1141137807 16:81478050-81478072 AGGGAGAGGAGGCCAGAATAGGG + Intronic
1141611830 16:85185930-85185952 AGGGCGCGGAGGCCTGAGCAGGG + Intergenic
1141637338 16:85321317-85321339 GGAGAGAGGAGGGCGAAGAAGGG + Intergenic
1141707383 16:85674580-85674602 TGGAGGAGGAGGCCTGAGAGCGG - Exonic
1141779612 16:86150851-86150873 GTGGAGAGGAGGCGGGAGCAGGG + Intergenic
1141864442 16:86740518-86740540 TGGGAGGGGAGGCGGGAGAAGGG + Intergenic
1141968583 16:87464177-87464199 GGGGAGAGGAGGGCTGAGCAGGG + Intronic
1142288653 16:89182262-89182284 GGGGAGGGGAGGCTTGGGGAGGG - Intronic
1142889153 17:2931813-2931835 GGGAAGAGGAAGGCTGAGCAAGG - Intronic
1142917474 17:3153771-3153793 AGGGAGGGGAGTGCTGAGAAGGG + Intergenic
1143012033 17:3871220-3871242 GGGAAGAGGAGGGCTCAGCAGGG + Intronic
1143376192 17:6469014-6469036 AGGGAGAGGACCCCTGAGATAGG - Intronic
1143473658 17:7191371-7191393 AGGGAGAGCAGGCCTGAGACTGG + Intronic
1143481182 17:7228078-7228100 GGGAAGAGGAGGCCTCAGGAGGG + Intronic
1143514207 17:7411312-7411334 GAGGAGAGGAAGCCTGGGTAAGG + Intronic
1143531818 17:7509504-7509526 GGGGTGAGGAGCCATGAGAAAGG - Intronic
1143600715 17:7944086-7944108 TAGGAGAAGAGGCCTGAGACTGG - Intronic
1143965814 17:10755929-10755951 GGGGGGAGGGGGACAGAGAAAGG - Intergenic
1144038150 17:11385694-11385716 CAGGTGATGAGGCCTGAGAATGG + Intronic
1144290734 17:13823679-13823701 GTGGAGAGGAGGGCTTATAAGGG + Intergenic
1145349583 17:22069027-22069049 TGGGAGAGGAGGACTGACACGGG + Intergenic
1146147000 17:30427846-30427868 GGGGAGAGGAGGTAAGAGAAGGG - Intronic
1146291776 17:31612924-31612946 GGAGAGAGGTGGCAGGAGAAAGG - Intergenic
1146835250 17:36105385-36105407 GCGGAGAGGAGTCCTGAGTATGG - Exonic
1146849874 17:36212642-36212664 GCGGAGAGGAGTCCTGAGTATGG - Exonic
1146926694 17:36750512-36750534 GTGGACAGGAAGCCTGAGGACGG - Intergenic
1146948443 17:36889954-36889976 GGGAAGAAGAGGCCTGGGACAGG - Intergenic
1147155663 17:38543452-38543474 GGGTAGGCCAGGCCTGAGAAGGG + Intronic
1147426334 17:40347600-40347622 GGGGAGAGATGGCATGACAAAGG - Intronic
1147668545 17:42163759-42163781 GAGGAGACAAGGGCTGAGAATGG + Exonic
1147741098 17:42671334-42671356 GGGGAGGTGAGGCCAGAGAAAGG - Exonic
1147995959 17:44360649-44360671 AAGGACAGGAGGGCTGAGAAAGG + Intronic
1148068867 17:44894626-44894648 CTGGAGAGGAGGCATGTGAAAGG - Intronic
1148085635 17:44992143-44992165 GGGGAGTGGAGTCCAGAGAGGGG + Intergenic
1148550388 17:48546791-48546813 GGGGAGAGGAGGATGGAGAAAGG + Intergenic
1148557546 17:48587469-48587491 GGGGAGACTAGCCCTGGGAAGGG + Intronic
1148821428 17:50361955-50361977 GGGGAGAGGAGGCTTGGGAAAGG - Intronic
1148857119 17:50584831-50584853 GGAGAGAGGAGACCTAAGAAGGG + Intronic
1148910832 17:50941795-50941817 GGGAAGAGGAGGCATCAGGAAGG - Intergenic
1149311836 17:55401962-55401984 GGGGAGATGAGGCAGGAGAATGG + Intronic
1149527261 17:57366346-57366368 GGAGGGAAGAGGCGTGAGAAGGG - Intronic
1150483831 17:65530770-65530792 TGGGAGAAGAGGCCTGGAAATGG - Intronic
1150484410 17:65533752-65533774 GGGGAGAGAAGAAATGAGAAGGG + Intronic
1150952834 17:69821962-69821984 GCAGAGAGGAGGCCCTAGAATGG - Intergenic
1150979959 17:70130142-70130164 GGTCATAGGAGGCATGAGAATGG - Intronic
1151147366 17:72053603-72053625 GGGGGGCGGAGGACAGAGAAGGG - Intergenic
1151358747 17:73575896-73575918 GGGGAGAGGAGGTATAAAAAGGG + Intronic
1151386442 17:73757949-73757971 GGGGAAGGGAGGGGTGAGAAAGG - Intergenic
1151398963 17:73843317-73843339 GGGGAGATGGAGCATGAGAAAGG + Intergenic
1151474600 17:74338539-74338561 GGGAAGAGGAGGCCTGACCCTGG - Intronic
1151518537 17:74612825-74612847 GGGGAGAGGTGGGGAGAGAAGGG - Intronic
1152110185 17:78353456-78353478 GGGGGAAGGAGGCCTCAGACAGG - Intergenic
1152129438 17:78467110-78467132 GGGCAGATGAGGCCCCAGAACGG + Intronic
1152275568 17:79354686-79354708 GGGGAGAGGAGCCCTCAGGAGGG + Intronic
1152378386 17:79930034-79930056 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1152741978 17:82022459-82022481 GGGGAGATGAGGCCCCAGGACGG - Intronic
1152812337 17:82387930-82387952 GGGGAGAGGGGGACAGAGACTGG + Intergenic
1152911691 17:83008909-83008931 GAGGTGAGGATGCCTGCGAATGG + Intronic
1153130141 18:1846430-1846452 GAGGAGAGGAGATCTGAGCATGG + Intergenic
1153166023 18:2263042-2263064 TGGGAGACGAGGCTGGAGAAAGG + Intergenic
1153990550 18:10395127-10395149 GGGCAGAGAAGTGCTGAGAAGGG - Intergenic
1154309870 18:13259160-13259182 GGGGAGAGGAGGACGAAGGAAGG - Intronic
1154437449 18:14357729-14357751 GGGGAGACGAGACCTGGGCATGG - Intergenic
1156059473 18:33056229-33056251 GGGGAGAGAAGGGATGAGCAGGG + Intronic
1156369634 18:36461095-36461117 AGGGAGGGCAGGGCTGAGAAGGG + Intronic
1156470804 18:37376274-37376296 GGGGATAGGAAGCCAGAGGAAGG - Intronic
1156491372 18:37498393-37498415 GGGAAGAGGAGGGAAGAGAAGGG - Intronic
1156534873 18:37853062-37853084 GGGCAGAGGAGGCCTGAAAGAGG - Intergenic
1156585222 18:38424560-38424582 GGGGAGCTGAGGCAGGAGAATGG - Intergenic
1156863287 18:41862991-41863013 GGGGAGAGGAGGTGAGGGAATGG + Intergenic
1157214928 18:45774797-45774819 GGGCAGTGGAGGCTTCAGAAAGG - Intergenic
1157996074 18:52557762-52557784 GGGGGGCTGAGGCATGAGAATGG - Intronic
1158058683 18:53312894-53312916 GGGGAGAGGAGGGAAGGGAAAGG + Intronic
1158613545 18:58965356-58965378 GAGGAAATGAAGCCTGAGAAAGG + Intronic
1158642993 18:59219516-59219538 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
1158643006 18:59219546-59219568 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
1158643010 18:59219556-59219578 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
1158796614 18:60854084-60854106 GGAAAGAGGAGGCATAAGAAAGG + Intergenic
1158949050 18:62475006-62475028 TGGGAGCGAAGGCCTGGGAAGGG + Intergenic
1159915335 18:74182986-74183008 GGGGAGAGGAGGGGAGAGGATGG - Intergenic
1159961015 18:74555669-74555691 GGGGAGAGGAGGGAGGAGACAGG + Intronic
1160015849 18:75139812-75139834 AGGGAGTGAAGGCCTGAGGAAGG - Intergenic
1160072781 18:75643057-75643079 GGGGAGAGGTGGCCTCAGAAAGG + Intergenic
1160269733 18:77373159-77373181 GGGGAGAGGGGTCCTGAGCGTGG - Intergenic
1160269793 18:77373359-77373381 GGGGAGAGGGGTCCTGAGTGTGG - Intergenic
1160542162 18:79629809-79629831 GGGGACGGGAGGCGTGGGAAGGG + Intergenic
1160702935 19:517357-517379 GGGGAGGAGAGGCCTGAGCTGGG + Intronic
1160711174 19:551664-551686 GGGGAGGGGAGGGGAGAGAAGGG - Intergenic
1160797597 19:953095-953117 GGGGAGGGGAGTCCTGAGCCGGG + Intronic
1160872089 19:1282250-1282272 AGGGAGCGGAGGACTGAGAAGGG + Intergenic
1161235166 19:3194022-3194044 TGGGGGAGCAGGGCTGAGAAGGG + Intronic
1161439015 19:4279991-4280013 GGGGAAAGGGGCCCGGAGAAGGG + Exonic
1161459930 19:4390533-4390555 AGGGAGAGGAGGGGAGAGAAGGG + Intronic
1161649765 19:5477363-5477385 GGGGAGCTGAGGCAGGAGAATGG - Intergenic
1161745346 19:6056216-6056238 GTGGAGAGGAGGACGGAGAGTGG + Intronic
1161803545 19:6429508-6429530 GAGGAGAGGAGGAAGGAGAAAGG + Intronic
1161846223 19:6713322-6713344 AGGGAGAGGAGGGCTCAGAGAGG + Intronic
1162178467 19:8849039-8849061 GTGAGGAGGAGGCGTGAGAATGG + Intronic
1162206585 19:9060551-9060573 GGGAGGCTGAGGCCTGAGAATGG + Intergenic
1162551186 19:11359342-11359364 GGGGAAAGGAGGTGAGAGAAGGG - Intronic
1162612681 19:11768191-11768213 GAGGAGAGAAAGCCTGAGGAAGG - Intronic
1162805756 19:13137246-13137268 GGTGAGAGGAAGCCGGAGGATGG - Intronic
1162806481 19:13140241-13140263 GGGGAGAGGAGGGGTGACTAAGG - Exonic
1162876812 19:13626660-13626682 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
1162877087 19:13628347-13628369 GGGGAGAGGAGGAGAGGGAAGGG + Intergenic
1163017810 19:14467535-14467557 GGAGAGAGGAGGCCAGAGTAAGG - Intronic
1163182500 19:15614577-15614599 GGACAGAGGGGGCCTGTGAAGGG - Intergenic
1163183858 19:15622807-15622829 AGGGAGAGGAGGTCTGAGTTTGG + Intronic
1163351185 19:16777507-16777529 GGGGAGGGGAGAGGTGAGAAAGG + Intronic
1163365934 19:16876228-16876250 GGTGAGAGGAGGCCTGGGGCTGG + Exonic
1163546520 19:17944008-17944030 GGGGAGAGGCGGGCGAAGAATGG + Intergenic
1163599666 19:18241369-18241391 GGGAAGCTGAGGCCGGAGAATGG - Intronic
1163646884 19:18494712-18494734 GGGGAGGGGAGGGCAGAGAGTGG - Intronic
1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG + Intronic
1163771113 19:19192016-19192038 GTGGAGGGGCGGCCTGACAAAGG - Intronic
1165362072 19:35342913-35342935 GGGGAGCTGAGGCAGGAGAATGG - Intronic
1165404965 19:35624207-35624229 GGGAAGCTGAGGCATGAGAATGG - Exonic
1165412468 19:35670504-35670526 GGGGAGAGGAGGCGAGGGGAGGG - Intronic
1165440684 19:35825177-35825199 GGGGAGGGGAGGGGAGAGAAGGG + Intergenic
1165459909 19:35938185-35938207 TGGGAGAGATGGCCAGAGAAAGG - Intronic
1165637469 19:37354229-37354251 GGGGAGAGGAGGGGAGAGGAGGG - Intronic
1165709812 19:38003039-38003061 GGGAAGCTGAGGCATGAGAATGG + Intronic
1165782127 19:38441022-38441044 GAGGGGTGGAGGTCTGAGAAGGG + Intronic
1165793878 19:38507435-38507457 GAGGAGAGAAGGGCTGAGAAGGG + Intronic
1165828533 19:38719225-38719247 TGGGAGAGGAGTCCTGTGAGTGG - Intronic
1165911316 19:39230011-39230033 GGGGAGGGGAGGGGAGAGAAGGG + Intergenic
1166460664 19:42985260-42985282 GGGGAGAGGGGGTCTTAGGAAGG - Intronic
1166679814 19:44759418-44759440 GCGGAGAGAAGACCTGAGGAAGG - Exonic
1166690359 19:44818731-44818753 GGGGAGTGGAGTCCTGGGAAGGG - Exonic
1166732851 19:45068388-45068410 GGGGAGAAGAGGCGGGAGAGGGG - Intronic
1166947073 19:46404016-46404038 CGGGAGAGGAAGCCAGAGGAAGG - Intergenic
1167188373 19:47964494-47964516 GGTAAGAGGAGGCCAGAGAACGG - Intergenic
1167211400 19:48136130-48136152 GGAGAGAGCAGGCCAGGGAAGGG + Intronic
1167283252 19:48583711-48583733 GGGAAGCTGAGGCATGAGAATGG + Intronic
1167486867 19:49767733-49767755 GTATAGAGGAGGCCTGAGAGTGG + Intronic
1167599803 19:50448013-50448035 GGAGCGAGGAGGCCTGAGGGAGG - Intronic
1167665494 19:50820976-50820998 GAGGAGGGGAGGCCTGAGAGCGG + Intronic
1167671750 19:50857489-50857511 GGGGAGGGGAGGCCTCAGAGTGG - Intronic
1167722901 19:51190980-51191002 GGGCCGAGGTGGCCTGGGAAAGG - Intergenic
1168085647 19:54043880-54043902 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
1168509330 19:56961755-56961777 GGGGAGAGGAGACACGAGAGAGG - Intergenic
1168562178 19:57393684-57393706 GGGGAGGGGAGGGCAGAGGAGGG + Intronic
1168642346 19:58038692-58038714 GGGGAGAGGGGAGCTGAGAGAGG - Intronic
1168705939 19:58470361-58470383 GGGGAGTGGGTGCCTGAGAAGGG + Intronic
925449948 2:3960601-3960623 CAGGAAAGGAGGGCTGAGAAAGG - Intergenic
925862601 2:8194478-8194500 GGGGAGAGGAGGGAGGAGGATGG - Intergenic
925881077 2:8353029-8353051 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
925881086 2:8353049-8353071 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
925881103 2:8353089-8353111 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
926202092 2:10808653-10808675 TGGGAAAGGATGCCTGTGAATGG + Intronic
926210979 2:10869083-10869105 TGGGAGAGGTGCCCTGAGAGAGG + Intergenic
926212036 2:10878460-10878482 GGGGAGGTGTGGCCTGAGAGGGG + Intergenic
926360370 2:12081152-12081174 GGGGGGAAGAGGCAGGAGAATGG + Intergenic
926440363 2:12882691-12882713 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
926623238 2:15067412-15067434 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
926623242 2:15067422-15067444 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
926623246 2:15067432-15067454 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
926623250 2:15067442-15067464 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
926623254 2:15067452-15067474 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
927037508 2:19194401-19194423 GCTGAAAGGAGGCCAGAGAAGGG - Intergenic
927121536 2:19968863-19968885 GGGTAGAGAAGGGCAGAGAATGG - Intronic
927497275 2:23559400-23559422 GGGTAGAGAATGGCTGAGAAGGG + Intronic
927678056 2:25121444-25121466 CAGCAGGGGAGGCCTGAGAAGGG + Intronic
927723657 2:25404356-25404378 GGGCAGAAGAGGCTTGGGAAGGG + Intronic
927914363 2:26925373-26925395 GCTGAGAAGAGGCCTGAGCAGGG + Intronic
928143767 2:28752528-28752550 GGGGAGAGGATGCCTGCCACTGG + Intronic
928264855 2:29802521-29802543 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
928479387 2:31666619-31666641 GGGAAGATGAGGTCTAAGAAAGG + Intergenic
929601375 2:43206739-43206761 GGGGAGAGGTGCCCTGAGGCTGG - Intergenic
929724710 2:44412969-44412991 GGGGGGCGGAGGCAGGAGAATGG + Intronic
929936337 2:46297072-46297094 GGGGAGAGGCAGCCTGCGCAGGG - Intronic
930190678 2:48455908-48455930 GGGGAGCTGAGGCAGGAGAATGG + Intronic
930569344 2:53065208-53065230 GGGGAGAGGAGGGAAGAAAAAGG + Intergenic
930865599 2:56119683-56119705 GGGAAGCTGAGGCATGAGAATGG - Intergenic
931191325 2:60003074-60003096 GACGAGAGGAGGCATGGGAAGGG + Intergenic
931559985 2:63550410-63550432 AGTGAGATAAGGCCTGAGAAAGG - Intronic
931816560 2:65909040-65909062 GAGGAGAGGAGGACTTAGACAGG + Intergenic
931991757 2:67797206-67797228 GGGGAGAGGATGTCAGAGGAGGG - Intergenic
932430522 2:71671416-71671438 AGGGAGAGGGGGCCTGGGAGTGG + Intronic
933082997 2:78017100-78017122 GGGAAGAAGAGGTCAGAGAAGGG - Intergenic
933204736 2:79493226-79493248 GGGGAGGGGAGGGGAGAGAAGGG + Intronic
933785525 2:85838220-85838242 GATGGGAGCAGGCCTGAGAATGG + Intergenic
934488388 2:94738530-94738552 GGGGAGAAGAGACCTGGGCATGG + Intergenic
934555828 2:95286659-95286681 GGGGAGAGGAGGGGAGGGAAGGG - Intronic
934555833 2:95286669-95286691 GGGGAGAGGAGGGGAGAGGAGGG - Intronic
934555837 2:95286679-95286701 GGGGAGAGGAGGGGAGAGGAGGG - Intronic
934555841 2:95286689-95286711 GGGGAGAGGAGGGGAGAGGAGGG - Intronic
934564103 2:95328963-95328985 GAGGAGGGGAGGGCAGAGAATGG + Intronic
934566141 2:95342656-95342678 GGGAACAGCGGGCCTGAGAACGG - Intronic
935213200 2:100955833-100955855 GGGGCGGGGAGTCCTGAGTAGGG - Intronic
935762461 2:106334104-106334126 GGGAAGCTGAGGCCAGAGAATGG - Intergenic
936117035 2:109710770-109710792 GGTGAGAGGAGACCTGGGGAAGG + Intergenic
936346767 2:111681488-111681510 GGTTGGAGGAGGCATGAGAAGGG - Intergenic
936447481 2:112607287-112607309 GGGAAGGGGAGGCCAGGGAAGGG - Intergenic
937265161 2:120610762-120610784 GGGGTGAGCAGGCCTCAAAACGG + Intergenic
937886041 2:126900610-126900632 GAGATGAGGAGGCCTGAGAGTGG - Intronic
938120878 2:128632264-128632286 TGAGAGAGCAGGCCTGGGAAGGG - Intergenic
938839899 2:135150163-135150185 AGGGGGAGGAGGCCTGAAAGTGG + Intronic
938957702 2:136314601-136314623 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
938957711 2:136314621-136314643 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
938957720 2:136314641-136314663 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
938957729 2:136314661-136314683 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
938957738 2:136314681-136314703 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
938957759 2:136314726-136314748 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
939534506 2:143410757-143410779 GGCCAGAGAAGGCCTCAGAAAGG + Intronic
939614695 2:144349140-144349162 GGGGAGTGGGGAACTGAGAAGGG + Intergenic
940128455 2:150354425-150354447 GTGAAGATGAGGGCTGAGAATGG + Intergenic
940849074 2:158671376-158671398 GGGGTGGGGAGGGCTGGGAAGGG + Intronic
940894240 2:159064911-159064933 GGGGAGGGGAGGAATGAGGACGG - Intronic
940897214 2:159092258-159092280 AGGAAGGGAAGGCCTGAGAAAGG - Intronic
941350364 2:164425366-164425388 GGGGGTAGGAGGCCTGGGCAGGG - Intergenic
941807338 2:169722554-169722576 GGGGAGGGGAGGACCGAGACTGG - Intronic
941834189 2:169997764-169997786 TGTGAGAGGGGGCCTGAAAATGG + Intronic
941951325 2:171160245-171160267 CGGGAGAGGAGGCCCGCGAGCGG + Intronic
942245965 2:174008469-174008491 GGAAAGATGAGGCCAGAGAAAGG - Intergenic
942377957 2:175356220-175356242 TGGGAGAGGAGGCATGGGATTGG + Intergenic
942944283 2:181656652-181656674 GGGGAGGGGAGGCGAGAAAAGGG + Intronic
943060550 2:183038170-183038192 GAGGGGAGGAGGCCCGAGAGAGG - Exonic
943605000 2:189966532-189966554 GGGAAGAGGAGGCAAGAGGAAGG + Intronic
943728953 2:191281540-191281562 GGGGAGGGGAGGCCGGAAGAAGG - Intronic
944265569 2:197721717-197721739 GGGGAGTGGAGGCGGGAGGAGGG - Intronic
944395526 2:199262189-199262211 AAGGAGAGGAGGTCAGAGAAGGG + Intergenic
944586711 2:201179234-201179256 GTGGAGAGGAGGCCCTGGAAAGG - Intergenic
944840400 2:203618555-203618577 GGGAAGCTGAGGCATGAGAATGG + Intergenic
944933414 2:204544058-204544080 GAAGAGAGCTGGCCTGAGAATGG + Intergenic
946056646 2:216908624-216908646 GTGTTGAGGAGGCTTGAGAAAGG - Intergenic
946326390 2:218986604-218986626 GGGTGGAGGAGGCCTGGGAATGG + Intergenic
946408379 2:219504693-219504715 GAGCAGAGGAGGCCTTAGATGGG - Intronic
946446909 2:219747911-219747933 GGGGAGGGGAGGGCAGGGAAAGG - Intergenic
946481984 2:220066122-220066144 GGGTAGAGAAGGCATTAGAAAGG - Intergenic
946622432 2:221573549-221573571 GAGGAGGGGCGGCCTGGGAAGGG - Intronic
946685972 2:222270322-222270344 GGGGAGAGAAGCCCTGACAATGG - Intronic
946809845 2:223512204-223512226 GAGGAGTGGAGGGCTGAGAAAGG - Intergenic
946934022 2:224700918-224700940 GGGAAGAGGAAGTCTGAGGATGG - Intergenic
947198592 2:227595084-227595106 GGGAAGATGAGGCAGGAGAATGG - Intergenic
947669612 2:231927878-231927900 GGGAAGGGGTAGCCTGAGAAAGG - Intergenic
947875978 2:233468605-233468627 GGGGAGAGGATGGAAGAGAAGGG - Intronic
948173943 2:235928590-235928612 GAGGAGAGCAGGGCGGAGAAGGG + Intronic
948248473 2:236506194-236506216 GGGAAGAGGAGACCTGGCAAAGG - Intronic
948258792 2:236587860-236587882 GGGGACAGGACCCCTGTGAAGGG + Intergenic
948314230 2:237014921-237014943 GGGAAGCCGAGGCATGAGAATGG - Intergenic
948514213 2:238493413-238493435 GGGGAGGGGAGGGCTCCGAAAGG - Intergenic
948840827 2:240648074-240648096 GGGCAGAGGTGGCCAGAGAGGGG + Intergenic
1168830281 20:841754-841776 GGTGAGAGGAGGCCTCAGAGGGG + Intronic
1168879936 20:1197833-1197855 GGGGACAGGAGGCATGCAAAGGG - Intergenic
1168893889 20:1310765-1310787 GGGGTGAGGAGGGGTGAGGAGGG + Intronic
1169334296 20:4742682-4742704 GGAGAGAGGAGGCAAGAGGAGGG - Intergenic
1169381308 20:5109921-5109943 AGGGAGAAGAGGGCAGAGAATGG + Intronic
1169723383 20:8702996-8703018 GGGGAGAGGTGGACAGAGAGAGG + Intronic
1169781419 20:9314519-9314541 GTGGAGAGAATGCCAGAGAAGGG + Intronic
1170041586 20:12045231-12045253 GGGGAGGGGAGGGCTTAGGAGGG - Intergenic
1170041680 20:12045436-12045458 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1170306476 20:14944231-14944253 AGGGAGAGGAGGGCTGGGGAAGG + Intronic
1170442680 20:16395181-16395203 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
1170442683 20:16395191-16395213 GGGGAGAGGAGGGAAGAGGAGGG + Intronic
1170632979 20:18080977-18080999 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1170823235 20:19771851-19771873 GGAGGCAGGAGGCTTGAGAAGGG - Intergenic
1170917545 20:20642126-20642148 GGGGAGGGGAGGGGAGAGAAGGG + Intronic
1171291506 20:23985375-23985397 GGAGAGGGGAAGCCTGAGCAGGG + Intronic
1171406379 20:24914858-24914880 AGGGAGCTGAGGCCTGAGGATGG - Intergenic
1171406392 20:24914899-24914921 AGGGAGCTGAGGCCTGAGGACGG - Intergenic
1172027966 20:31962394-31962416 TGGGAGATGAGGTCAGAGAAAGG + Intergenic
1172116499 20:32576389-32576411 AGGGAGAGGAGGTCAGAGAAAGG + Intronic
1172383177 20:34513990-34514012 AGGTAGAGGAGGCATGAGACAGG - Intergenic
1172792366 20:37514619-37514641 CAGGAAAGGAGGCCAGAGAAGGG - Intronic
1172941432 20:38657154-38657176 GGGGAGTGGAGACATGAGACAGG + Intergenic
1173427843 20:42958288-42958310 GGGGAGAGGAGGGGAGGGAAGGG + Intronic
1173655005 20:44693969-44693991 TGGGACAGGAGGTTTGAGAAGGG + Intergenic
1174366960 20:50062299-50062321 GGTGAGAGGAGGCCTATGAAGGG - Intergenic
1174750011 20:53102478-53102500 GGGGAGAGGAGGGGAGAGGAAGG + Intronic
1174924511 20:54742789-54742811 GGGGTGGGGAGGGATGAGAAAGG + Intergenic
1175181086 20:57148187-57148209 GTGGACAGGGGTCCTGAGAAAGG + Intergenic
1175443394 20:59005743-59005765 TGGGAGAGAAGGCGGGAGAAGGG - Intronic
1175838363 20:62011007-62011029 GGGCAGTGTAAGCCTGAGAATGG + Intronic
1175877486 20:62237212-62237234 GGGGAGACAAGGCCTGAGGAGGG + Intronic
1175948213 20:62568504-62568526 GGGGAGAGGGGGCAGCAGAAGGG + Intronic
1176052024 20:63124873-63124895 AGGGAGAGGAGGCCTCAGACAGG + Intergenic
1176102328 20:63370216-63370238 GGGGAGGGCAGGGCTGAGGAGGG - Intronic
1176310203 21:5145279-5145301 GCGGAGAGGAGGCCTCACAAGGG + Intronic
1176370421 21:6058861-6058883 GGCCAGAGGAGGCCAGAGAAGGG + Intergenic
1176708862 21:10133679-10133701 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1176839604 21:13827910-13827932 GGGGAGACGAGACCTGGGCATGG + Intergenic
1177109180 21:17003293-17003315 GGTGTGAGGAGGGCTGAGAATGG - Intergenic
1177243905 21:18497665-18497687 GGGGAGAAGATACATGAGAAAGG + Intergenic
1178155618 21:29850466-29850488 GGGGAGAGGATATCTGAGATTGG - Intronic
1178170583 21:30035299-30035321 GGGGAGGGGAGGGGAGAGAAAGG - Intergenic
1178481335 21:32981813-32981835 GGGGAGGGAAGGCGAGAGAAGGG - Intergenic
1178729156 21:35083122-35083144 GGGGAGAGCAGGATAGAGAAAGG + Intronic
1178796029 21:35745207-35745229 AGGGAGAAGAGTCCTCAGAAAGG - Intronic
1179084881 21:38207680-38207702 GGGGAGAGGAGGGGAGAGAAGGG - Intronic
1179084934 21:38207830-38207852 GGGGAGAGGAGGGGAGAGGAGGG - Intronic
1179255605 21:39712830-39712852 GGGACAAGGAGGCCTGTGAATGG - Intergenic
1179753098 21:43479680-43479702 GGCCAGAGGAGGCCAGAGAAGGG - Intergenic
1179846853 21:44116757-44116779 GCGGAGAGGAGGCCTCACAAGGG - Intronic
1179954747 21:44732344-44732366 GGGGAAAGGAGCACTGGGAATGG + Intergenic
1180037516 21:45257410-45257432 GTGGAGATGAGGCCCGGGAATGG - Intergenic
1180104279 21:45607649-45607671 GAGGGGAGGAGGGATGAGAAAGG + Intergenic
1180106646 21:45623096-45623118 GGGGAGCGGGCCCCTGAGAACGG - Intergenic
1180142488 21:45900764-45900786 GAGCACAGGAGGCCTGAGTAGGG - Intronic
1180292965 22:10860944-10860966 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180456489 22:15515346-15515368 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180495771 22:15890366-15890388 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180765890 22:18345718-18345740 GGAGAGGGGAAGCCTGAGCAGGG - Intergenic
1180780423 22:18516660-18516682 GGAGAGGGGAAGCCTGAGCAGGG + Intronic
1180813139 22:18773981-18774003 GGAGAGGGGAAGCCTGAGCAGGG + Intergenic
1180840202 22:18955503-18955525 GGTGAGAGGAGGACGGAGAGGGG - Intergenic
1180880570 22:19200735-19200757 GGGGAGCTGAGGCAGGAGAATGG + Intronic
1181199316 22:21208297-21208319 GGAGAGGGGAAGCCTGAGCAGGG + Intronic
1181400445 22:22647560-22647582 GGAGAGGGGAAGCCTGAGCAGGG - Intronic
1181648922 22:24248231-24248253 GGAGAGGGGAAGCCTGAGCAAGG + Intergenic
1181702424 22:24628658-24628680 GGAGAGGGGAAGCCTGAGCAGGG - Intronic
1181937477 22:26449174-26449196 GCAGAGAGGAGGCCAGATAATGG - Intronic
1182021729 22:27087082-27087104 AGGGGGTGGGGGCCTGAGAAAGG + Intergenic
1182300831 22:29335962-29335984 GGGGAAAGGAGGCCTGATTGGGG - Intronic
1182445280 22:30386423-30386445 GGTGAGAGGAGGCCAGAGAGAGG - Intronic
1182477304 22:30583171-30583193 GAGGAGAGGAGGGCTGGGGAAGG + Intronic
1182550883 22:31100197-31100219 GAGGAGAGCAGGACAGAGAAAGG - Intronic
1182592126 22:31389503-31389525 GGGGAGGGGAGGCAAGGGAAGGG - Intergenic
1182950934 22:34375165-34375187 AGGAAGAAGAGGCCAGAGAAAGG - Intergenic
1182959974 22:34462871-34462893 AGGGTGTGGAGGCCTAAGAAGGG - Intergenic
1183078501 22:35441649-35441671 GGGCAGAGGAGGACTGGGCAAGG + Intergenic
1183180663 22:36257733-36257755 GAGGAGAGGAGGGCTGGGAGAGG + Intronic
1183246517 22:36697800-36697822 GCAGAGAGCAGGCCTTAGAATGG - Intronic
1183290574 22:36999535-36999557 GGGGAGGGGAGGGGAGAGAAGGG + Intronic
1183354461 22:37350870-37350892 GGGTGGAGGAGTCCTGAGAGGGG - Intergenic
1183360144 22:37379073-37379095 GAGGAGGTGAGGACTGAGAATGG + Intronic
1183688591 22:39375816-39375838 GGGGGGAGGAGGCCACAGACAGG - Intronic
1184210870 22:43034921-43034943 GGGGAGGGGAGGGGTGGGAAGGG + Intergenic
1184661919 22:45969345-45969367 TGGGAGAGGAAGACTGAGAGCGG + Intronic
1184687585 22:46103625-46103647 GTCCAGAGGAGGCCGGAGAAGGG + Intronic
1184717707 22:46291296-46291318 GTGGACAGGAGGGCTGAGGATGG + Intronic
1185119968 22:48960306-48960328 AGGGACAGGAGGTCTGAGATGGG - Intergenic
1185190340 22:49432517-49432539 GGAGAACGGAGGCCTGAGAGGGG + Intronic
1185409404 22:50674344-50674366 GGGGGGAGGGGGCCTGAGACGGG - Intergenic
1203227509 22_KI270731v1_random:86609-86631 GGAGAGGGGAAGCCTGAGCAGGG - Intergenic
949221768 3:1642897-1642919 GGGGAGGGGAGGGGAGAGAAGGG + Intergenic
950118283 3:10465108-10465130 GGGGAGAGGAGGCTTGGGGCTGG - Intronic
950160892 3:10760221-10760243 TGGGAGAGGCTGCCTGAGGAAGG - Intergenic
950305053 3:11910797-11910819 GTGGGGAGCAGGCCTGAGCAGGG + Intergenic
950352932 3:12374773-12374795 GGGGACAGGAGGCTGGGGAAGGG + Intronic
950384092 3:12642792-12642814 GGGGAGAGGATGCCTTAACAGGG + Intronic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
950813603 3:15674444-15674466 GGGGAGAGTAGGTCTGGCAAGGG + Intronic
952590904 3:34952771-34952793 CGTCAGAGGAGGCCTGAGAGTGG + Intergenic
952615067 3:35261044-35261066 GAGGAGATGAGGCCTGAATAGGG + Intergenic
952793572 3:37219127-37219149 GGGGAAAGGGAGCTTGAGAAGGG - Intergenic
953043080 3:39272228-39272250 TGGGTAAGGAGGCCTGAGGATGG - Intronic
953502848 3:43454681-43454703 GGTAAGGTGAGGCCTGAGAAAGG + Intronic
953828097 3:46271617-46271639 GAGGAGAGGAGGAGAGAGAACGG + Intergenic
954159479 3:48710565-48710587 GGGCAGGTGAGGCCTGGGAAAGG - Intronic
954171306 3:48804771-48804793 GAGGAGAGGAGGTCAAAGAATGG + Intronic
954368267 3:50157251-50157273 GGGAAGAGGCGGCCAGAGGAAGG - Intronic
954381904 3:50223675-50223697 GGTCAGAGTGGGCCTGAGAAAGG + Intergenic
954629551 3:52040548-52040570 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629582 3:52040656-52040678 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629598 3:52040710-52040732 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629615 3:52040764-52040786 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954855710 3:53642074-53642096 GGGGAGGGGAGGGGAGAGAAGGG + Intronic
954948379 3:54446799-54446821 AGGGAGGGGAGGCCAGGGAAGGG - Intronic
955099254 3:55831341-55831363 GGGGAGGGGAGGGGAGAGAAGGG + Intronic
955286293 3:57644708-57644730 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
955286317 3:57644753-57644775 GGGGAGGGGAGGGGTGAGGAGGG + Intronic
955744476 3:62126246-62126268 AGGGGCAGGAGGCCAGAGAATGG + Intronic
955968960 3:64417935-64417957 GGGGGTAAGAAGCCTGAGAAAGG + Intronic
956130256 3:66046639-66046661 GGGAGGAGGAGGCGGGAGAATGG - Intergenic
956857257 3:73287319-73287341 GAGGAGAGGAGGCCATTGAATGG + Intergenic
956991070 3:74766220-74766242 AGGGAGAGCCTGCCTGAGAATGG - Intergenic
957704300 3:83759780-83759802 GGGAAGCTGAGGCCGGAGAACGG - Intergenic
958480860 3:94643842-94643864 GGGTAGAGGAGGCAGTAGAAAGG - Intergenic
960111265 3:113847735-113847757 GGGCTCAGGAGGCCTGAGAAAGG + Intronic
960592852 3:119381879-119381901 GGGAGGATGAGGCCAGAGAATGG + Intronic
961011166 3:123437063-123437085 GGGGAGTGGAGAAATGAGAAAGG + Intronic
961213925 3:125145115-125145137 GGAAAGCTGAGGCCTGAGAAAGG + Intronic
961372626 3:126440800-126440822 GGGCAGAGGTGGGCTGGGAAGGG - Intronic
961375566 3:126463171-126463193 GGGGAGCTGAGGCAAGAGAACGG - Intronic
961402591 3:126657706-126657728 GGGGAGGGGAGGAGGGAGAATGG - Intergenic
961459108 3:127039080-127039102 GGGCAGGGAAGGCCTGAGGAGGG + Intergenic
961514351 3:127423455-127423477 AGGGAGAGGAGGAGAGAGAATGG - Intergenic
961633401 3:128317899-128317921 GGGTGGGGGAGCCCTGAGAAAGG - Intronic
961669991 3:128522087-128522109 GAGGAGAGGCTTCCTGAGAATGG + Intergenic
961676292 3:128568970-128568992 GGGCAGGGGCGGCCTGGGAATGG + Intergenic
961678115 3:128580490-128580512 GGGGACAGGCTGCCTGAGAATGG + Intergenic
961713196 3:128842674-128842696 GGTGGGAGCAGGCCTGAGCAGGG - Intergenic
961901144 3:130213114-130213136 GAGGAAAGGAGGCCTGAAAAGGG + Intergenic
962285724 3:134084358-134084380 AGGGAGAGGCAGCCTGGGAAGGG + Intronic
962315613 3:134357656-134357678 GGGCAGAGGAGGGGAGAGAATGG + Exonic
962843371 3:139254885-139254907 GGCTAGAGGAGCCCAGAGAATGG - Intronic
963084750 3:141426518-141426540 GAGGAGAGGAGGCCGGGGGAGGG + Intronic
963626364 3:147679246-147679268 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
964011135 3:151893221-151893243 GGGGAGAGTGGGCCTGGAAACGG - Intergenic
964160542 3:153640558-153640580 GGGTAGAGGAAGCCCCAGAAAGG + Intergenic
964233257 3:154495482-154495504 AGGGAGAGGAGAAATGAGAACGG - Intergenic
966402648 3:179563177-179563199 GGGGAGGGGAGGGCTGGGAGCGG - Intronic
966427133 3:179791789-179791811 TGGGAGAGGAGGTCAGAGAGGGG + Intergenic
966771566 3:183508526-183508548 GTGGAAAGGAGGCCAGAAAATGG + Intronic
966979850 3:185121992-185122014 GGGAAGCGGAGGCAGGAGAATGG + Intronic
967184092 3:186930676-186930698 GGGGAGGGGAGTCCTGGGCAGGG + Exonic
967217396 3:187222073-187222095 GGGGAGAGGAAGCCAGGGCAGGG + Intronic
967605318 3:191438411-191438433 GGGGAGGGGAGGGAAGAGAAGGG - Intergenic
967812822 3:193774865-193774887 CGGGAGAGGAGGCATGAGAATGG + Intergenic
968056925 3:195698831-195698853 GAGGAGAGGAGACGTGAGAGAGG - Intergenic
968129110 3:196182097-196182119 AGGGAGAGGAAGCCTGGGAGGGG - Intergenic
968611372 4:1558653-1558675 GGGGAGAGGAGGGAAGGGAAAGG + Intergenic
968741394 4:2333289-2333311 GGGTAGGGGAGGCCAGAGGAGGG - Intronic
968826340 4:2900452-2900474 GGGGAAAGAAGGCCTCAGAGGGG + Intronic
968911996 4:3481094-3481116 GGGGATAGGAGGCGTGAGGGTGG + Intronic
969392672 4:6901711-6901733 GGGGAGGGGATGCCTGAGATGGG - Intergenic
969481352 4:7448689-7448711 GGGGAGAGGAAGGCAGAGAGAGG - Intronic
969978998 4:11135035-11135057 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
970542768 4:17096045-17096067 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
970772909 4:19637994-19638016 GGGGAGGGGAGGCGAGGGAAGGG - Intergenic
970779919 4:19724526-19724548 GGGGAGTGGGGGGCTGAGGAGGG - Intergenic
970803944 4:20007728-20007750 AGGGAAAGGAGGAATGAGAAGGG + Intergenic
971282339 4:25251157-25251179 GGAGAGAAGAGGACTGTGAATGG + Intronic
971771262 4:30899773-30899795 GGGGTGAGGTGGGCTGGGAATGG + Intronic
971948926 4:33317246-33317268 TGTGAGAGGAGGCCTGAAAGTGG + Intergenic
972301998 4:37793165-37793187 GGGCAGAGAAGGGCAGAGAAGGG + Intergenic
972461408 4:39307025-39307047 GGTGAGAGGTGGCATGAGGATGG - Intronic
972579903 4:40385951-40385973 GGGGAGGGGAGGCCAGGGGAGGG + Intergenic
973573892 4:52266569-52266591 GAGGAGAGGAGACCAGAAAAAGG + Intergenic
973629864 4:52810366-52810388 GGGGAGGGGTGGCATGAGATGGG + Intergenic
973811168 4:54571613-54571635 GGAAAGAGGAGGCCTGGGAGAGG + Intergenic
975185467 4:71397133-71397155 GGGGAGAGGAGGTCTGGGCCTGG + Intronic
975811107 4:78170878-78170900 GGAGGGAGGTGGCCTGAGAAAGG - Intronic
975862408 4:78691560-78691582 GGAGAGAGGAAGCCAGAGATGGG - Intergenic
977216139 4:94286168-94286190 GGAGAGAGGTGGTATGAGAATGG + Intronic
977520909 4:98082554-98082576 GGGGAGCTGAGGCAGGAGAATGG - Intronic
977687440 4:99864266-99864288 TGGGAGAAGAGTCTTGAGAAAGG + Intronic
978801114 4:112756131-112756153 GGGGAGCTGAGGCAGGAGAATGG + Intergenic
978822965 4:112987228-112987250 GGGTAGAGGAAGTCTGAGACAGG - Intronic
978833360 4:113116494-113116516 GGGGTGAGCAGGTCTGGGAAGGG - Intronic
979480776 4:121214447-121214469 GTGGAGAAGAGGCAAGAGAATGG + Intronic
979871563 4:125829263-125829285 TGGGAAAGGAGGCCTGAAGAGGG + Intergenic
981454471 4:144937576-144937598 GGGGAGCTGAGGCAGGAGAATGG + Intergenic
981550690 4:145938032-145938054 GGGGGGAGGGGGCAAGAGAAGGG - Intronic
981636474 4:146886565-146886587 GAGGAGAGAAGGCCTGATAAAGG + Intronic
981729723 4:147884802-147884824 TGGGAGAAGAGGCTTGAGATGGG + Intronic
981857052 4:149307295-149307317 GGGGAGAACATGCCTGGGAATGG + Intergenic
982073924 4:151719930-151719952 GCTGAGAGGAGTCCTGAGGAAGG + Intronic
982162061 4:152580152-152580174 GGGGAGCAGAGGCCTAAGGACGG - Intergenic
982337885 4:154260195-154260217 GGGGAAAGGAGGCCCGGCAATGG - Intronic
983271260 4:165564718-165564740 GGGTAGGGGAGGGCAGAGAAGGG - Intergenic
984013868 4:174403267-174403289 GGGGAGAGGAGAGCAGAGTAAGG + Intergenic
984261862 4:177452313-177452335 GGGGAGAGGAGGGGTGGGGAGGG - Intergenic
984402063 4:179279004-179279026 GAGGAGAGGAGGCAAGGGAAGGG - Intergenic
984641115 4:182165152-182165174 GAGTAGATGATGCCTGAGAAGGG - Intronic
984702878 4:182829441-182829463 GGGGAGAGGATGCCCCAGCATGG + Intergenic
984878224 4:184388435-184388457 GTGGAGTGGATGCCTCAGAACGG - Exonic
985265960 4:188153475-188153497 GGGGAGAGTGGGGGTGAGAAGGG + Intergenic
985622612 5:963352-963374 GGGGAGAGGAAGCCAGTGCAAGG - Intergenic
985658106 5:1142445-1142467 GGGGAGTGGAGGGCAGAGAGGGG - Intergenic
986156304 5:5179845-5179867 GGTGAGAGGAGGCAAGACAAAGG - Intronic
986741981 5:10712508-10712530 GTGCAGAGGAGGACTGAGCACGG + Intronic
987092447 5:14520558-14520580 CATGAGAGGAGGCCTTAGAACGG + Intronic
987589442 5:19904381-19904403 GGGGAGGGGAGGGAAGAGAAGGG + Intronic
987683899 5:21171808-21171830 AGGGAGAGGAGGGCAGGGAAAGG + Intergenic
988793400 5:34630115-34630137 GGGGAGAGGAGGGCAGTGATAGG - Intergenic
988801172 5:34698103-34698125 GGGGAGGGGAGGGGGGAGAAAGG - Intronic
988893199 5:35642341-35642363 GGGAAGAGGAGAGATGAGAAGGG - Intronic
989099923 5:37813951-37813973 GGGGAGCAGATGGCTGAGAAGGG - Intronic
989190862 5:38668416-38668438 TGGGAGAGGAGGCCTTTGATGGG - Intergenic
989224190 5:39006705-39006727 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
989224194 5:39006715-39006737 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
989224198 5:39006725-39006747 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
989224202 5:39006735-39006757 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
989224206 5:39006745-39006767 GGGGAGAGGAGGGGAGAGGAGGG + Intronic
989582398 5:43045177-43045199 GTGCAGAGGAGCCCAGAGAAGGG + Intergenic
990457825 5:56005154-56005176 GGGGAGGGGAGGACAGAGGAGGG - Intergenic
990671010 5:58130262-58130284 GGGGAGGGGAGGGGAGAGAAGGG - Intergenic
991662658 5:68966327-68966349 AGGGAGAGTGGGCCTGAGAGAGG - Intergenic
992088726 5:73299698-73299720 GGGGTGAGGAAGCCTGGGAGAGG - Intergenic
992269471 5:75051154-75051176 GGGGAGGGGAGAGGTGAGAAAGG - Intergenic
992579012 5:78151908-78151930 GGGGAGAGGAGGGATGGGGACGG - Intronic
992646082 5:78812346-78812368 GGGGAGGGGAGGACAGAGCATGG + Intronic
994050752 5:95359489-95359511 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
994429861 5:99644122-99644144 GGGGAGGTGAGGCAGGAGAATGG + Intergenic
994954418 5:106510169-106510191 GGGGAGGGGAGGGCAGAGGAGGG - Intergenic
995062930 5:107831107-107831129 GGGGAGAGGAGGAGTGTGGAAGG - Intergenic
995179538 5:109218168-109218190 GGGGACAGGAGGCTGGATAAAGG - Intergenic
996461806 5:123753590-123753612 GGGGAGGGGAGGGGAGAGAAGGG - Intergenic
996523306 5:124450972-124450994 GGGGTGAGGAGCCCTGAGTTAGG - Intergenic
996681591 5:126233281-126233303 GTGGAGAGGATGCGTGAGAAAGG + Intergenic
997060723 5:130499217-130499239 GGGAAGCTGAGGCCGGAGAATGG + Intergenic
997117906 5:131145828-131145850 GGGGAGCTGAGGCCGGAGGATGG - Intergenic
997305245 5:132831221-132831243 GGGGAGAGGGGGGCGGAGCACGG + Intergenic
997353767 5:133249149-133249171 TGGGACAGGAGGCCTCTGAACGG - Intronic
997464008 5:134074634-134074656 GAGGAGAAGAGGCCTGGGAAGGG - Intergenic
997509493 5:134443952-134443974 GTGGAGAGGAAGCCTCAGAGGGG + Intergenic
997647127 5:135489098-135489120 GGGGAGAGGACGGCTGGGCAAGG + Intergenic
997759143 5:136428174-136428196 GGGGAGAGGAGGGGAGAGAAGGG - Intergenic
998256394 5:140591864-140591886 GAGGAGAGGAGACCTCAGAGAGG + Intronic
998392060 5:141793565-141793587 GAGGGGAGGAGGCTGGAGAATGG - Intergenic
998498433 5:142611284-142611306 GGTGAGAGGAGTCCTGGGCACGG - Intronic
998519090 5:142783557-142783579 GGGGAGAGGAGGAGAGAGACTGG + Intronic
998681589 5:144473778-144473800 GGGGAGAGCTGGCCTCAGACTGG - Exonic
999073927 5:148777263-148777285 GGGAAGAGGAGCACTCAGAAAGG - Intergenic
999353866 5:150905056-150905078 ACGGAAAGGAGGCCTGCGAAAGG + Intergenic
999644888 5:153707836-153707858 TGGGAGAGGAGGTGTGAGACTGG + Intronic
1000099559 5:158002137-158002159 GGGAAGCTGAGGCATGAGAACGG + Intergenic
1000298702 5:159935649-159935671 GGGAGGCCGAGGCCTGAGAATGG - Intronic
1000929621 5:167235630-167235652 AGGGAGAGCTGGTCTGAGAAAGG - Intergenic
1001273345 5:170332044-170332066 GGGGAGATGAGACCTCAGGAAGG + Intergenic
1001348999 5:170938045-170938067 GGAGGGAGGAGGTCAGAGAAAGG - Intronic
1001397281 5:171426429-171426451 GGGGAGGGCTGGCCTTAGAAGGG + Intronic
1001411499 5:171515596-171515618 GAGGCGAGGAGGCCCGAGAGAGG + Intergenic
1001525232 5:172424052-172424074 GGGGGGAGCCTGCCTGAGAAAGG + Intronic
1001549552 5:172593321-172593343 GCTGAGAGGAGGCCCGAGGATGG + Intergenic
1001584585 5:172825047-172825069 GGGGGGCTGAGGCATGAGAATGG - Intergenic
1001622183 5:173096491-173096513 GGGGAGAGGAGGGCAGGGGAGGG - Intronic
1001963840 5:175896380-175896402 GGGGAGGGGAGGGCTGGGGAAGG - Intergenic
1002065173 5:176648123-176648145 AGGGAAAGGAGGCCGGGGAAGGG - Intronic
1002070178 5:176674355-176674377 GGGGATGGGGGGCCTGAGCAGGG - Intergenic
1002129063 5:177068458-177068480 GGAGAGAGCTTGCCTGAGAAAGG - Intronic
1002441186 5:179265324-179265346 GGGGAGAGGTGGCGGGGGAAGGG + Intronic
1002594594 5:180313720-180313742 GGGCAGAGCAGGCCGGAGGAGGG + Intronic
1002596287 5:180325590-180325612 TGGGACAGGAGGCCTGAGTGAGG - Intronic
1004204116 6:13575117-13575139 GGGGGGAGGCGGCTTGAGGACGG + Intronic
1004320166 6:14625899-14625921 GGGGAGAGGAAGAAGGAGAAGGG + Intergenic
1005169665 6:22968515-22968537 GCGGGGAGGAGGACTGAGCAAGG - Intergenic
1005310686 6:24556178-24556200 GGGGAGAGGAGGGCAGAGGAGGG - Intronic
1005319795 6:24642024-24642046 GGGGAGGGGAGGGGAGAGAAAGG + Intronic
1005583021 6:27251323-27251345 GGGAAGAGGAGGCCAGAGAAGGG + Intronic
1006167401 6:32073211-32073233 TGGCAGAGGACTCCTGAGAAGGG + Intronic
1006425929 6:33962992-33963014 GGAGAAATGAGGCCTGAGGAGGG - Intergenic
1006436020 6:34026600-34026622 GGGGTGTGGAGGCCTGGGGAGGG - Intronic
1006510760 6:34519936-34519958 GGGGAGGGCATGCCTAAGAATGG + Intronic
1006669737 6:35722566-35722588 GGGGAGATGAGGCCAGAGGCAGG - Intronic
1006677390 6:35774209-35774231 CTGGAGAGGAGGCCTGGGGATGG - Intergenic
1006747322 6:36352467-36352489 GGGGTGAGAGGGCCTGGGAAGGG - Intergenic
1006813759 6:36837648-36837670 GGTGAGAGGATGCCTGAAAGTGG + Intronic
1006931140 6:37689161-37689183 GGCGGGAGGAGGCCTGAGAGGGG - Intronic
1007075607 6:39064382-39064404 AGGGAGTGAAGGCCAGAGAATGG - Intronic
1007340713 6:41189797-41189819 GTGGAGAGGAGGCCTGAAAGAGG + Intergenic
1007581349 6:42962085-42962107 GGGGAGAGGAGGCAGAGGAACGG + Intronic
1007603772 6:43101445-43101467 GGGAAGCTGAGGCATGAGAATGG + Intronic
1007663991 6:43503785-43503807 GGGAAGAGGAGGACAGAGAGAGG - Intronic
1007817480 6:44534728-44534750 GGGGTGAGGAGGCGGGAGAGTGG + Intergenic
1008047984 6:46871391-46871413 TGGGAGAGGAGGAATGAGGAAGG + Intronic
1008515276 6:52313045-52313067 GGGGAGAGGAGGTATCAGTAAGG - Intergenic
1008565467 6:52763817-52763839 TGGGAGAGGATGTCTGTGAAGGG + Intergenic
1008569655 6:52804158-52804180 TGGGAGAGGATGTCTGTGAAGGG + Intergenic
1008602907 6:53113001-53113023 AGAGAGCAGAGGCCTGAGAAGGG - Intergenic
1008667415 6:53729679-53729701 GGGGAGATCAGGGCTGAGTAAGG + Intergenic
1009750137 6:67871417-67871439 GGGGAGAGGAGGTGATAGAAGGG - Intergenic
1009750376 6:67872944-67872966 GGGGAGAGGAGGTGATAGAAGGG + Intergenic
1010062868 6:71645429-71645451 GGGGAGAGAGGGAGTGAGAAAGG + Intergenic
1010062874 6:71645457-71645479 GGGGAGAGAAGGAGCGAGAAAGG + Intergenic
1010062881 6:71645483-71645505 GGGGAGAGAGGGAGTGAGAAAGG + Intergenic
1010220192 6:73442182-73442204 GGGCAGAGGTGGCCTTTGAAAGG - Intronic
1011072375 6:83399968-83399990 GGTAAGATGAGGTCTGAGAATGG - Intronic
1011137873 6:84118662-84118684 GGGTAGAGCCTGCCTGAGAAGGG - Intergenic
1011200938 6:84835454-84835476 GGGCAGAGCAGGGCAGAGAATGG - Intergenic
1011804593 6:91057946-91057968 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1012337341 6:98077150-98077172 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1012551287 6:100466639-100466661 GGGGAGAGGAGGGTCAAGAAAGG - Intergenic
1012939435 6:105402154-105402176 GGTGAGAGGAGGTCTTAGAAGGG - Intronic
1013073275 6:106748504-106748526 GCGGAGAGGATGCGAGAGAAAGG - Intergenic
1013479702 6:110543244-110543266 GGGGAGAGCTGGCATGAGCAGGG - Intergenic
1014252356 6:119127754-119127776 GGGGAGAGAAAGGTTGAGAAGGG + Intronic
1014513555 6:122354808-122354830 GGGGAGGGGAGGGGAGAGAAGGG + Intergenic
1014513564 6:122354828-122354850 GGGGAGGGGAGGGGAGAGAAGGG + Intergenic
1015071906 6:129104765-129104787 GTGGAGTGGAGGGCAGAGAAGGG - Intronic
1015784164 6:136903769-136903791 TGGGAGTGGAGGCTTGAGATGGG - Intronic
1016526910 6:145011663-145011685 GGGAAGAGGAAGACTGAAAAGGG + Intergenic
1017570754 6:155741999-155742021 GGGGTGAAGAGGGATGAGAATGG - Intergenic
1017716903 6:157219106-157219128 GGGGAGTGGGGGCCGGTGAATGG + Intergenic
1018160558 6:161038055-161038077 GAGGAGAGAAAGCGTGAGAAAGG - Intronic
1018328783 6:162705209-162705231 GGGGAGAGGCAGTCTAAGAAAGG - Intronic
1018457281 6:163963413-163963435 GGGGAGAGGTGGCTGGGGAACGG + Intergenic
1018890269 6:167977465-167977487 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890290 6:167977513-167977535 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890311 6:167977561-167977583 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890332 6:167977609-167977631 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890353 6:167977657-167977679 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890394 6:167977753-167977775 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890413 6:167977801-167977823 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890434 6:167977849-167977871 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018978584 6:168583873-168583895 GGGCAGAGGAGGGCAGAGGAGGG + Intronic
1019010762 6:168841910-168841932 GGGGACAGGAGGGATGAGACAGG + Intergenic
1019106601 6:169672807-169672829 AGTGAGAGGAGGCTGGAGAAAGG + Intronic
1019200264 6:170308043-170308065 GTGAAGGGGAGGCCAGAGAAAGG - Intronic
1019385793 7:755355-755377 GAGGAGGAGAGGCCTGAGCATGG - Intronic
1019520780 7:1459687-1459709 GGGGCCAGGAGGCGTGGGAACGG - Intergenic
1019543343 7:1561109-1561131 GGGGTGAGGGGGCCAAAGAAGGG - Intergenic
1019597635 7:1865573-1865595 GAGGACTGGAGACCTGAGAAGGG + Intronic
1019749399 7:2719239-2719261 CGGGAGAGGCGGCCGGAGGATGG - Intronic
1019805036 7:3117509-3117531 GGGGAGAGGAGAGATGAGAAAGG + Intergenic
1021313494 7:19118335-19118357 GGGGAAAGGAGGGCCCAGAAGGG - Intergenic
1021572846 7:22083121-22083143 GGGGGGTGGGGGCCGGAGAATGG - Intergenic
1022140518 7:27489174-27489196 GGAGAGATGAGGCTTGAGGAAGG - Intergenic
1022374671 7:29802432-29802454 ATGGAGGGGAGGACTGAGAAAGG + Intergenic
1022513207 7:30956263-30956285 GGGGAGATGAGGGAAGAGAAGGG - Intronic
1022673269 7:32475805-32475827 AGGGAGAGTGTGCCTGAGAATGG + Intergenic
1023027094 7:36060576-36060598 GGGAGGAGGAGGCAGGAGAATGG + Intergenic
1023062719 7:36343537-36343559 GGGGAGAGGAGGGGAGGGAAGGG + Intronic
1023258355 7:38334438-38334460 AGGGAGGGGAGGCCAGAAAAAGG + Intergenic
1023273642 7:38494373-38494395 GGGGACAGGTGGACTGAGCAAGG + Intronic
1023281267 7:38572861-38572883 GGGCAGAGGAAGCGTGAGCATGG + Intronic
1023480024 7:40624195-40624217 TGGGGGAGGAGGCCTGAGGTGGG - Intronic
1023625515 7:42111594-42111616 CAGGAGAGCAGGCCTGAGGAAGG + Intronic
1023743591 7:43302349-43302371 GGGAAGCTGAAGCCTGAGAAGGG - Intronic
1023991563 7:45131972-45131994 GGGGAGGGGAGAGCAGAGAAAGG - Intergenic
1024146082 7:46517513-46517535 GACTAGAGGAGTCCTGAGAATGG - Intergenic
1024263665 7:47590264-47590286 AGGGAGAGAAGGATTGAGAAAGG - Intergenic
1024291434 7:47807412-47807434 GGGGAGAAGGGGCCTGAAGATGG + Intronic
1024517514 7:50271963-50271985 GGGTGGAGGAGGCCTAAGAGGGG + Intergenic
1025007211 7:55363957-55363979 GGGGACAGGAGGCTGAAGAAAGG + Intergenic
1026468436 7:70674175-70674197 GGGGAGGGGGGCCCTGAGAAAGG + Intronic
1026743745 7:72995375-72995397 GGGGAGGGGAGGGGAGAGAAGGG + Intergenic
1026902803 7:74046371-74046393 GGGGGGAGCAGGCCTGGGATGGG - Intronic
1026913432 7:74106052-74106074 GGGGACAGCAGGCATGTGAATGG - Intronic
1026935748 7:74254380-74254402 GGGAAGAGGAGGCGCGAGAATGG - Exonic
1027029855 7:74880073-74880095 GGGGAGGGGAGGGGAGAGAAGGG + Intergenic
1027099990 7:75369702-75369724 GGGGAGGGGAGGGGAGAGAAGGG - Intergenic
1027547082 7:79540987-79541009 GGGGAGAGGGGGGTGGAGAAAGG + Intergenic
1028797907 7:94925761-94925783 GGGGAGAAGAGGAAGGAGAAAGG - Intronic
1028899088 7:96075849-96075871 GGGGAGAGGGGGCCTCTCAAGGG - Intronic
1029130661 7:98328212-98328234 TGGCTGAGGAGGCCGGAGAAGGG + Intronic
1029155990 7:98518460-98518482 GGGGAAAGGGGGACTGAGAGTGG - Intergenic
1029171083 7:98629255-98629277 GGGGGGAGGGGGGCTCAGAAAGG + Exonic
1029600357 7:101559680-101559702 GGGGTGAGGTGGCCTCTGAAGGG - Intergenic
1029642273 7:101828809-101828831 TGGGAGAGGAGGGCTTAGAGAGG + Intronic
1029746001 7:102516222-102516244 AGGCAGAGGAGCTCTGAGAAGGG - Intronic
1029763939 7:102615201-102615223 AGGCAGAGGAGCTCTGAGAAGGG - Intronic
1030196365 7:106857487-106857509 TGGGAGAGGAGGCCCAAGGAGGG - Intergenic
1030365529 7:108641568-108641590 GGGGAAAGGAGGGGAGAGAAGGG - Intergenic
1030380022 7:108800886-108800908 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
1030461390 7:109840276-109840298 GGGAAGAGGAGGCCAGAGGTCGG + Intergenic
1030704099 7:112673534-112673556 GCAGGGAGGAGGCCAGAGAATGG - Intergenic
1031136148 7:117886291-117886313 GGAGAGGGCAGGCCTGAGAGTGG + Intergenic
1031151682 7:118061313-118061335 GGGGAGAGGAGGTGTGAGGAGGG - Intergenic
1031196472 7:118620893-118620915 GGGGAGTGGAGGGCTGGGGAGGG - Intergenic
1031575891 7:123415476-123415498 TGGGAGAGGATGACAGAGAAAGG - Intergenic
1031879132 7:127176823-127176845 GGGGAGAGGAAGCAGCAGAAAGG + Intronic
1032076409 7:128838213-128838235 GGGGAGAGCAGTCCTGAGAGGGG - Intronic
1032119469 7:129145533-129145555 GGGTAGATGAGGCCTGCAAAAGG - Intronic
1032490272 7:132319093-132319115 GAGGAGAGGAGGTTTCAGAAGGG - Intronic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1033356059 7:140601464-140601486 GGGGAGAGGAGGGCAGAGGCGGG + Exonic
1033388429 7:140902378-140902400 GGGAATAGGAGGCCCAAGAAGGG - Intronic
1033591113 7:142809180-142809202 GGGGAGGGGAGGCCTGCACATGG - Intergenic
1033664930 7:143431384-143431406 CGGGAGAGTAGGCATGATAAAGG - Intergenic
1034010904 7:147528389-147528411 TGGCACAGGAGGCCAGAGAAGGG + Intronic
1034376109 7:150645898-150645920 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1034441716 7:151089009-151089031 GGGAACAGCAGGGCTGAGAACGG - Intronic
1034531053 7:151696770-151696792 AGGGAGGAGAGGCCTGAAAAGGG + Intronic
1034700106 7:153088199-153088221 GGGAAGTGGAGGCGGGAGAAGGG + Intergenic
1034816363 7:154175396-154175418 GGGAGGAGAAGGCCTGAGAAGGG + Intronic
1034867002 7:154650343-154650365 GTGGAGAGGAGGGCAGAGGAGGG + Intronic
1034883445 7:154779395-154779417 AGGCAGAGGAGACCTAAGAATGG - Intronic
1034976189 7:155450342-155450364 GGGGAGAGGAGCTCTGTGGAGGG - Intergenic
1035004544 7:155645090-155645112 GCGGAGAGGAGGAGCGAGAAAGG - Intronic
1035153267 7:156892768-156892790 GGGGAGAGGAGGGGTGGGGAGGG + Intronic
1035161286 7:156951810-156951832 TGGGAGATGAGGCAGGAGAATGG - Intronic
1035308172 7:157946799-157946821 CGGGACAGTAAGCCTGAGAAGGG + Intronic
1036592487 8:10181633-10181655 GTGGAGAGGAGCCCAGAGAGAGG + Intronic
1036638026 8:10564844-10564866 GGGGAGAGAAGGCCCTGGAAAGG + Intergenic
1036651603 8:10647485-10647507 GGGGAGAGGAGAAATGAGGATGG - Intronic
1037071541 8:14656392-14656414 GAGGAGAGGAGGAAAGAGAAAGG - Intronic
1037654017 8:20867573-20867595 GGGGAGAGGAGGAGCTAGAAGGG + Intergenic
1037822418 8:22141418-22141440 GGGTAGAGGAGGTCTGAGGGCGG + Intronic
1037876923 8:22552918-22552940 GGGGAGTGGAGGGCTGAGGCTGG - Intronic
1038672777 8:29595710-29595732 TGGGAGAGGAGGACGGAGCAGGG + Intergenic
1038734484 8:30156573-30156595 GGGGCGGGGAGGGTTGAGAAGGG + Intronic
1039306983 8:36273493-36273515 GGGAGGCGGAGGCATGAGAATGG - Intergenic
1039922491 8:41903369-41903391 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
1039922495 8:41903379-41903401 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
1040328995 8:46376451-46376473 GGGGAGAAGCGGCGTGACAACGG + Intergenic
1040504781 8:48037358-48037380 GGGGAGAAGAGGCAAAAGAAAGG - Intronic
1040525663 8:48222297-48222319 GGGGAGAGGAGGCATGAGGGAGG + Intergenic
1040681909 8:49820749-49820771 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
1041130269 8:54691610-54691632 GAGAAGAAGAGGCATGAGAACGG + Intergenic
1041542028 8:58995989-58996011 GGGGAGAGCAGGCCTGGAAACGG - Intronic
1041859160 8:62491815-62491837 GGGGAAAGGAGGACTGAGAATGG + Intronic
1041887373 8:62826033-62826055 GGGAGGAGGAGGCCTGAGCCAGG - Intronic
1042093646 8:65188024-65188046 GGGGAGAGGAAGACTGAAGAGGG - Intergenic
1042477560 8:69266272-69266294 GGTGAGAGAAGGCCTGAGGAGGG + Intergenic
1042488020 8:69368028-69368050 GGGGAGCTGAGGCAGGAGAATGG - Intergenic
1042735077 8:71978866-71978888 GGAGAGAGGAGGCTGGTGAAGGG + Intronic
1042824481 8:72966240-72966262 GGGGAAAGCCTGCCTGAGAATGG - Intergenic
1043476671 8:80611875-80611897 TGGGGGATGAGGCATGAGAATGG + Intergenic
1043845388 8:85157262-85157284 GGGGAGTGGGGGCCTGGGAGAGG + Intergenic
1044014096 8:87029654-87029676 GACGAGAGGAGGAGTGAGAAAGG + Intronic
1045033726 8:98161631-98161653 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1045033730 8:98161641-98161663 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1045033734 8:98161651-98161673 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1045033738 8:98161661-98161683 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1045033742 8:98161671-98161693 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1045530211 8:102977509-102977531 GGGGATAGGAGGGCTGGGATAGG + Intronic
1045695796 8:104807467-104807489 AGGGAGAGAAGGTCTGACAATGG - Intronic
1046380535 8:113444267-113444289 GGGGAGGGGAGGGGTGAGGAGGG - Intergenic
1046421046 8:113982499-113982521 GGGTACAGGAGTCCTCAGAAAGG - Intergenic
1046827924 8:118712070-118712092 GGGGAAAGGCAGCCAGAGAATGG + Intergenic
1047208166 8:122819942-122819964 TGGGAGGGGAGGCCTGGGGAGGG - Intronic
1047389290 8:124437118-124437140 GGGGAAATGAGGGATGAGAAAGG + Intergenic
1047398399 8:124524913-124524935 GGGGAAATGAGGGATGAGAAAGG + Intronic
1047632671 8:126725452-126725474 CTGGAGAAGAGGCATGAGAATGG - Intergenic
1047681490 8:127258372-127258394 GAGGTGAGGAGGTCTGAGAAGGG + Intergenic
1047994192 8:130317896-130317918 GTGGAGAGGAGAGCTGAGGAAGG + Intronic
1048296149 8:133215613-133215635 GGGGTGAGGAGGACAGGGAAGGG - Intronic
1048572562 8:135667702-135667724 GGGAAGAGGAGGCCAGGGAGAGG + Intergenic
1048618418 8:136104876-136104898 GAGGACAGGATGCCTGAGAAGGG + Intergenic
1048688957 8:136937043-136937065 TGGGAGGTGAGGCATGAGAATGG + Intergenic
1049205199 8:141360452-141360474 TGGGAGAGGAGGGCAGAGACAGG - Intronic
1049288270 8:141788289-141788311 AGGGAGAGGAGAGCTGAGCAGGG - Intergenic
1049345284 8:142135611-142135633 GGGGAGAAGAGGCCACAGGAGGG - Intergenic
1049504588 8:142989178-142989200 GGAGAGGTGAGGTCTGAGAAGGG + Intergenic
1049591380 8:143464493-143464515 AGGGAGAGGATGCTTGGGAAGGG + Intronic
1050106177 9:2169159-2169181 GGGGTGAGGAGGCAGGTGAACGG - Intronic
1050255131 9:3786061-3786083 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1050255135 9:3786071-3786093 GGGGAGAGGAGGGGAGAGGAGGG - Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1050624770 9:7491185-7491207 AAGAAGAGGAGACCTGAGAAAGG + Intergenic
1050654342 9:7809883-7809905 GGTGAGCGGTGGCCTGAGAGTGG + Intronic
1050853720 9:10323223-10323245 GGGGAGGGGAGGGGAGAGAAGGG - Intronic
1050853734 9:10323253-10323275 GGGGAGGGGAGGGGAGAGAAGGG - Intronic
1051287698 9:15513178-15513200 GGGGAGGGGAGGGCAGGGAACGG + Intergenic
1052005558 9:23343787-23343809 GGAGAGGGCAGGCTTGAGAAAGG + Intergenic
1052237537 9:26229961-26229983 GGGTAGATGAGGCCTAAAAAAGG + Intergenic
1052323162 9:27190193-27190215 GGGAAGAGGAGGCTGGAGAGTGG + Intronic
1052706140 9:31995827-31995849 GGGGAGTGGGGGCCTGGGACAGG + Intergenic
1052840618 9:33289098-33289120 GGGGAGAGGAGGGATGACTAAGG - Intergenic
1053054718 9:34987797-34987819 GGGGTGAGGAGGAGTGAGGAAGG - Intergenic
1053072801 9:35111177-35111199 GGGGAGGAGAGGAGTGAGAAGGG - Exonic
1053214325 9:36258226-36258248 GGGGAGGGGAGGCCTGGGGCAGG + Intronic
1053230031 9:36400661-36400683 GGGGTGAGGAGGCCCGCGGACGG - Intronic
1053381106 9:37650564-37650586 GGGAAAAGGAGGCGTGAGAAGGG + Intronic
1053645838 9:40119176-40119198 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1053645844 9:40119203-40119225 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1053669402 9:40345835-40345857 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1053759874 9:41344333-41344355 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1053799557 9:41755713-41755735 GGGGGGAAGGGGTCTGAGAAGGG - Intergenic
1053919198 9:42972076-42972098 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1054326850 9:63717077-63717099 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1054326856 9:63717104-63717126 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1054380532 9:64485855-64485877 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1054515214 9:66030456-66030478 GGGGAGAAGAGACCTGGGCATGG + Intergenic
1054538727 9:66256769-66256791 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1054538733 9:66256796-66256818 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1056046421 9:82722243-82722265 GGTGAGAGGGGGAGTGAGAAAGG + Intergenic
1056298147 9:85214141-85214163 GGTGAGAGGAAGCCAGAGCAGGG + Intergenic
1056451077 9:86717330-86717352 GGGCAGAGAACGTCTGAGAAGGG - Intergenic
1057145670 9:92757600-92757622 GGGGAGCTGAGGCAGGAGAATGG + Intronic
1057695519 9:97320363-97320385 GAGGAGGGGAGGCCTTAGAAGGG - Intronic
1057766104 9:97920754-97920776 GGGGACAGAAAGCCTAAGAAGGG - Intronic
1057829491 9:98395835-98395857 GGGAAGAGCAGGCTTGAGAATGG + Intronic
1058487682 9:105458500-105458522 GTGGAGAGGAGTCCTGAAATGGG + Intronic
1058684203 9:107466116-107466138 GGGGAAACCTGGCCTGAGAACGG + Intergenic
1058935706 9:109767606-109767628 AGGGAGAGGAGGCCAGAGGGTGG - Intronic
1059063778 9:111060654-111060676 GGGGAGAAGAAGGCAGAGAAGGG + Intergenic
1059248354 9:112866993-112867015 GGGGGGAGGAGTTCTGAGGAGGG - Intronic
1059343212 9:113611358-113611380 AGGGTGAGGGGACCTGAGAAGGG + Intergenic
1059551317 9:115232065-115232087 GGGGAGAGGAGGGGAGAGGAGGG - Intronic
1059551321 9:115232075-115232097 GGGGAGAGGAGGGGAGAGGAGGG - Intronic
1059611989 9:115908292-115908314 GGGGATAGGAGGCTAGAGGAGGG + Intergenic
1059880446 9:118683363-118683385 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1060055970 9:120413385-120413407 TTGGGGAGCAGGCCTGAGAAAGG - Intronic
1060108692 9:120891244-120891266 GGGGAGAGGAGGGGAGAGAAGGG - Intronic
1060185277 9:121560356-121560378 GGGGAGAGGAAGAGGGAGAAAGG + Intergenic
1060355489 9:122904208-122904230 GGGGAGAGGAGGAATTAAAAAGG + Intronic
1060415653 9:123427944-123427966 GGGGAAAGCCTGCCTGAGAATGG + Intronic
1060602579 9:124888047-124888069 GGGGAGAAGAGGGCTGGGGAGGG + Intronic
1060743250 9:126113344-126113366 GGAGAGAGAAGGGGTGAGAAAGG + Intergenic
1060756813 9:126219731-126219753 CGGGAGAGGAGGTCGGAGAAGGG - Intergenic
1060816899 9:126639702-126639724 GGGCAGAGGAGGGCTCAGGATGG + Intronic
1061207137 9:129171291-129171313 GGGGAGGGGAGGCCGAACAAGGG - Intergenic
1061405795 9:130392368-130392390 CAGGAGACGAGGCCTGAGGACGG + Intronic
1061416622 9:130450704-130450726 GAGGACGGGAGGCCTGGGAAAGG + Intronic
1061513052 9:131072534-131072556 GGGGAATGGAGGCCACAGAAGGG + Intronic
1061572623 9:131487157-131487179 GGGCAGCGGCGGCCTGTGAACGG - Exonic
1061662451 9:132139246-132139268 GGGGAGGGGAGGGGAGAGAAGGG + Intergenic
1061662460 9:132139266-132139288 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
1061662469 9:132139286-132139308 GGGGAGGGGAGGGGAGAGAAGGG + Intergenic
1061817735 9:133206680-133206702 CAGGAGAGGAGACTTGAGAATGG + Intronic
1062008832 9:134256233-134256255 GGGGAGGGGAGGGCTCAGCAGGG + Intergenic
1062174048 9:135151134-135151156 GGGGAGATGAGGCTTGAACAGGG + Intergenic
1062206145 9:135338503-135338525 GAGAAGGGGAGGCCTGAGAGGGG + Intergenic
1062242659 9:135548504-135548526 GGGGAGAGGAGGCCTGAGAATGG - Intronic
1062264095 9:135678902-135678924 GGGGAGAGAAGGCCTGGGCCTGG - Intergenic
1062482604 9:136759429-136759451 GGGGTGAGGGGCCCTGGGAAGGG - Intergenic
1062520368 9:136955193-136955215 GGGGTGAGGGAGGCTGAGAAGGG - Intronic
1062690157 9:137837512-137837534 GGGGAGTGCAGGCCTGGGAAGGG + Intronic
1202793623 9_KI270719v1_random:102649-102671 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1185586967 X:1248053-1248075 GGGGAGAGGAGGGGAGAGGAGGG + Intergenic
1185610904 X:1393010-1393032 AGGGAGAGGAGGCGGGAGGAGGG - Intergenic
1185818866 X:3182594-3182616 GGGGAGATGAAGGCTGAGATAGG + Intergenic
1186188032 X:7040826-7040848 GGGGAGAGGGGGTCTTAGGAAGG - Intergenic
1186471084 X:9822624-9822646 GGGGAGGCGAGGGCTGAGCAGGG + Intronic
1186818989 X:13267041-13267063 GGGGCGGGGAGTCTTGAGAATGG - Intergenic
1187105946 X:16241948-16241970 TGGGAGAGAAGGACTGGGAAAGG - Intergenic
1187622963 X:21079007-21079029 GAGGAGATGAAGCCTGAGGAGGG - Intergenic
1188782929 X:34307601-34307623 GCGGAGAGGGGGCCTGAAAGAGG - Intergenic
1188788277 X:34375862-34375884 GGGGATAGGAGGGTTGCGAATGG + Intergenic
1189008382 X:37018943-37018965 AGGAAGAGGAGGCAGGAGAAAGG - Intergenic
1189040345 X:37536067-37536089 AGGAAGAGGAGGCAGGAGAAAGG + Intronic
1189110578 X:38286035-38286057 GGGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110605 X:38286107-38286129 GGGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110615 X:38286134-38286156 GGGAAGAGGAGGAAGGAGAATGG - Exonic
1189110632 X:38286182-38286204 GGGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110682 X:38286344-38286366 GGGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110711 X:38286431-38286453 GGGAAGAGGAGGAAGGAGAAGGG - Exonic
1189211223 X:39285477-39285499 TGGGAGAGGGAGCCTGAGGAAGG - Intergenic
1189779666 X:44502055-44502077 GGGAAGAGGAGGCCTGAGGAGGG - Intergenic
1189857088 X:45234199-45234221 GGGGAGAGGACAGCTGAGATAGG + Intergenic
1189927445 X:45971502-45971524 GGGAAGCTGAGGCATGAGAATGG + Intergenic
1190053578 X:47169655-47169677 TGGGAGAGGAGCCCTCAGAGAGG - Intronic
1190261880 X:48802496-48802518 GGAGGGAGAAGGCCTGAGAGAGG + Intronic
1190393795 X:49959437-49959459 GGGCACAGGAGAACTGAGAAGGG - Intronic
1190862442 X:54357742-54357764 GGCGAGAGGAGGCTCGAGAGAGG - Exonic
1191162435 X:57345177-57345199 GGGGAGAGGAGGGAAGGGAAGGG - Intronic
1192263811 X:69525054-69525076 GGGGAGGGGTGGCCTGACATTGG - Intronic
1192444731 X:71202307-71202329 GGGGAGGGGAGGGGAGAGAAGGG + Intergenic
1193108401 X:77704043-77704065 GGAGAGAGGAGGCCTGAGAGTGG + Intronic
1193156751 X:78182817-78182839 GGGTAGAGGAGGCAGCAGAAAGG + Intergenic
1193416620 X:81232582-81232604 TGAGAGAGAAGGCATGAGAAAGG - Intronic
1193420174 X:81273293-81273315 GGTGAGAGGAGCCAAGAGAATGG - Intronic
1195179043 X:102339309-102339331 GCAGAGAGGAGGCCTTAGAATGG + Intergenic
1195273321 X:103254399-103254421 GGGGAGGGGAGGCCAGAGACTGG - Intronic
1195616365 X:106915758-106915780 TGGGAGGGGAGGCAGGAGAAGGG - Intronic
1196049241 X:111287924-111287946 GGTGAGAGGTGACATGAGAAAGG - Intergenic
1196378000 X:115056009-115056031 GGAGAGAGGAGGAGTTAGAAGGG + Intergenic
1196586571 X:117436090-117436112 GGGGAGGGGAGGGAGGAGAAAGG - Intergenic
1196845904 X:119896480-119896502 GGGGAGAGGAGGGGAGGGAAGGG + Intronic
1196962238 X:121015500-121015522 GGGGAGCTGAGGCAGGAGAATGG - Intergenic
1197028754 X:121788347-121788369 GGGGAGGGGAGGGGAGAGAAGGG - Intergenic
1197486889 X:127062904-127062926 GGGGGGATGAGGCAGGAGAATGG + Intergenic
1198506365 X:137305008-137305030 GCAGAGAAGAGGACTGAGAAAGG - Intergenic
1199014271 X:142794268-142794290 GGGGAGCTGAGGCAGGAGAATGG + Intergenic
1199032102 X:143012940-143012962 GGAGAGAGGAGGTCTTAGAGTGG + Intergenic
1199103833 X:143838161-143838183 GGGGAGAGGAGGCCCTGGAGAGG - Intergenic
1199474541 X:148231096-148231118 GGGGAGAGGAGGAGAGAGAGAGG - Intergenic
1199527214 X:148805955-148805977 GCGGAGAGGGGGAATGAGAAAGG + Intronic
1199715735 X:150506291-150506313 GGGTAGAGGAGGAGGGAGAAGGG - Intronic
1199974460 X:152884759-152884781 TGGGAGTGGAGGCCAGAGAACGG + Intergenic
1201017652 Y:9622463-9622485 GGGAAGAGGAGGTGTGAGGATGG - Intergenic
1201052332 Y:9950252-9950274 GGGAAGAGGAGGTGTGAGGATGG + Intergenic
1201261468 Y:12162972-12162994 GGGGAGATGAAGGCTGAGATAGG - Intergenic
1202035022 Y:20624141-20624163 GGGGAGAGGAGGTGAGAGGAGGG - Intergenic
1202241165 Y:22771080-22771102 GGGAAGAGGAGGTGTGAGGATGG - Intergenic
1202394151 Y:24404823-24404845 GGGAAGAGGAGGTGTGAGGATGG - Intergenic
1202476634 Y:25265269-25265291 GGGAAGAGGAGGTGTGAGGATGG + Intergenic