ID: 1062242984

View in Genome Browser
Species Human (GRCh38)
Location 9:135549785-135549807
Sequence GAGGCTGCAGGGTAGGGCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1054
Summary {0: 2, 1: 2, 2: 16, 3: 117, 4: 917}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062242984_1062242994 16 Left 1062242984 9:135549785-135549807 CCTCTGCCCTACCCTGCAGCCTC 0: 2
1: 2
2: 16
3: 117
4: 917
Right 1062242994 9:135549824-135549846 CTTCCCAGCACAGCAGCCCCCGG 0: 2
1: 0
2: 6
3: 61
4: 563
1062242984_1062242995 17 Left 1062242984 9:135549785-135549807 CCTCTGCCCTACCCTGCAGCCTC 0: 2
1: 2
2: 16
3: 117
4: 917
Right 1062242995 9:135549825-135549847 TTCCCAGCACAGCAGCCCCCGGG 0: 2
1: 0
2: 3
3: 49
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062242984 Original CRISPR GAGGCTGCAGGGTAGGGCAG AGG (reversed) Exonic
900137055 1:1122132-1122154 GAGGCCACAGGGGAGGGCGGAGG - Intergenic
900140164 1:1136482-1136504 GTGGGTGCTGGGCAGGGCAGAGG + Intergenic
900187232 1:1338099-1338121 GGGGCAGCCGGGTGGGGCAGCGG + Exonic
900313617 1:2046614-2046636 GTGGCTGCAGGGTCTGGCTGAGG - Intergenic
900491084 1:2949563-2949585 CGGGCTGCAGAGTACGGCAGGGG + Intergenic
900491097 1:2949612-2949634 CGGGCTGCTGGGTACGGCAGGGG + Intergenic
900491110 1:2949661-2949683 CGGGCTGCAGGGTACGGCAGGGG + Intergenic
900491123 1:2949710-2949732 CGGGCTGCTGGGTACGGCAGGGG + Intergenic
900491136 1:2949759-2949781 CGGGCTGCTGGGTACGGCAGGGG + Intergenic
900491149 1:2949808-2949830 CGGGCTGCAGGGTACGGCAGGGG + Intergenic
900491162 1:2949857-2949879 CGGGCTGCTGGGTACGGCAGGGG + Intergenic
900491175 1:2949906-2949928 CGGGCTGCTGGGTACGGCAGGGG + Intergenic
900491187 1:2949955-2949977 TGGGCTGCTGGGTACGGCAGGGG + Intergenic
900491199 1:2950004-2950026 TGGGCTGCTGGGTACGGCAGGGG + Intergenic
900520934 1:3105227-3105249 GAGGCTGGTGGGCAGGACAGTGG - Intronic
900527397 1:3135906-3135928 GGGGCTGCAGAGCGGGGCAGGGG + Intronic
900605344 1:3521285-3521307 GAGGCAGGAAGGTAAGGCAGTGG + Intronic
900619633 1:3580838-3580860 CAGGCTCCGGGGTGGGGCAGGGG - Intronic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900807089 1:4774610-4774632 AAGAGTGCAGGGGAGGGCAGTGG - Intronic
900831220 1:4967120-4967142 GAGGGAGCAGGGGAGAGCAGTGG - Intergenic
900832606 1:4975929-4975951 TAGTCTGCAGGGCAGGGCATGGG + Intergenic
900943117 1:5814110-5814132 GAGGGTGAAGGGGAGGGGAGAGG - Intergenic
901003697 1:6161429-6161451 GAGGCTGGTGGGCAGGGGAGAGG - Intronic
901039679 1:6356400-6356422 GAGGGTGCTGGGCAGGGCTGAGG - Intronic
901568178 1:10136428-10136450 TAGGCTGCAGTGCAGTGCAGTGG - Intronic
901760484 1:11468077-11468099 GTGGCTGCAGGGAAGGGAACTGG + Intergenic
902096462 1:13950029-13950051 GGGGCTGCAGAGCAAGGCAGGGG - Intergenic
902534282 1:17110213-17110235 GAGGCTGCAGGGAGGGGCCCAGG + Intronic
902675626 1:18006653-18006675 GAGGCTCCAGGCCACGGCAGCGG - Intergenic
902802104 1:18836947-18836969 GGGGCTGCCAGGTAGGGCGGAGG + Intergenic
902881401 1:19374133-19374155 GAGCCAGCAGGGTACGGCGGGGG + Intronic
902937278 1:19773319-19773341 GAGGAAGCAGGGTTGGGCAGAGG + Intronic
903017196 1:20368867-20368889 GAGGCTGGAGGGAAGGAAAGGGG + Intergenic
903227322 1:21901343-21901365 GAGGGTGCATGGTAGGGGTGAGG + Intronic
903337607 1:22635436-22635458 GAGCCTGAAGGGTGGGGCGGGGG + Intergenic
903804801 1:25997738-25997760 GAGGAATCAGGGTAGGGCTGTGG + Intronic
903929673 1:26855085-26855107 GGGGCTGGTGGGTAGGGCTGGGG - Exonic
903945971 1:26962910-26962932 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
903977210 1:27158452-27158474 GAGACTTCAGAGAAGGGCAGGGG + Intronic
904019886 1:27455591-27455613 GTGGCTGCAGGCTAGAGCATTGG - Intronic
904211626 1:28889683-28889705 TAGGCTGCAGGGTGAGACAGAGG + Intronic
904244142 1:29174147-29174169 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
904314804 1:29653225-29653247 GGGGCTGCAGGGCAGGCCATGGG + Intergenic
904378305 1:30095364-30095386 GAGGCTGCAGGGTAAGGAAGAGG + Intergenic
904465587 1:30705376-30705398 GAGGCTGCCGGGCTGGGCAAGGG + Intergenic
904920065 1:34000375-34000397 GAGGCTGCAGAGTAAGGCAGTGG + Intronic
905034502 1:34908764-34908786 CAGGCTCCAGGGTGGGCCAGGGG - Intronic
906010239 1:42516525-42516547 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
906102017 1:43270056-43270078 GAGGCTGCAGCCTAGGGCCAAGG + Exonic
906205424 1:43984007-43984029 GAGACTGCAGGTTGGGGCAGGGG + Intronic
906214377 1:44030512-44030534 GCGGCCGCAGGTGAGGGCAGGGG - Intronic
906220879 1:44078475-44078497 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
907282760 1:53361858-53361880 TAGGCTCCAGGTTAGGCCAGGGG - Intergenic
907309197 1:53529696-53529718 GGGGCTACAGGGTAAGGCAGGGG + Intronic
907454711 1:54567920-54567942 GAGGCTGTAGGGGAGGGTGGTGG - Intronic
907774162 1:57496925-57496947 GAGGTTGGAGAGGAGGGCAGGGG - Intronic
908029331 1:59983135-59983157 GAGGCAGGAGGGATGGGCAGTGG + Intergenic
909512913 1:76475222-76475244 GAGGCTACAGTGTAGTGTAGCGG + Intronic
909622991 1:77687140-77687162 GAGGGGGGAGGGCAGGGCAGAGG - Intergenic
910227962 1:84955646-84955668 GTTTCTGCAGGGCAGGGCAGGGG + Intronic
910399749 1:86826639-86826661 GAGGCTGGAGGGGTAGGCAGAGG + Intergenic
911893877 1:103404968-103404990 GGGGAAGCAAGGTAGGGCAGAGG - Intergenic
912273409 1:108232202-108232224 GAGGCTGCCTGGGAGGACAGTGG + Intronic
912294811 1:108462120-108462142 GAGGCTGCCTGGGAGGACAGTGG - Intronic
912455738 1:109795766-109795788 GGAGCAGCAGGGCAGGGCAGAGG - Intergenic
912812379 1:112803957-112803979 TAGGATGCAGGGTGGGGGAGAGG - Intergenic
913163743 1:116167613-116167635 AAGGCTGCAAGGCAGGCCAGAGG - Intergenic
913349049 1:117837715-117837737 GAGGCTGGAGACTAGGGGAGGGG + Intergenic
913515639 1:119603414-119603436 GAGGCTGCTGGGGAGGACATGGG - Intergenic
913699734 1:121362652-121362674 GAGGCAGGAGGGCAGGGCGGTGG + Intronic
914137807 1:144917384-144917406 GAGGCAGGAGGGCAGGGCGGTGG - Intronic
914196174 1:145449114-145449136 GTGGATGGAGGGTGGGGCAGGGG + Intergenic
914433212 1:147638595-147638617 GAGGCTGGAGAGGTGGGCAGGGG + Intronic
914807629 1:151003156-151003178 CAGGGTGTGGGGTAGGGCAGAGG - Intronic
915298981 1:154941445-154941467 CAGGTTGCAGGGTAGGGGTGTGG - Intergenic
915320874 1:155055884-155055906 AAGGCGGCAGGGCAGTGCAGGGG - Intronic
915473766 1:156140573-156140595 GAAGCTGCAGGAGAGGGCAGAGG + Intergenic
916007359 1:160674643-160674665 AAGACTGCATGGTGGGGCAGAGG - Intergenic
916135840 1:161653042-161653064 TAGGCTGGGAGGTAGGGCAGAGG + Intronic
916354698 1:163891701-163891723 GAAGCTGGAGAGTAGGGGAGGGG + Intergenic
916409642 1:164533309-164533331 GAGTGTGGAGGGAAGGGCAGAGG - Intergenic
916704441 1:167333933-167333955 GAGACTAGAGGGTGGGGCAGTGG + Intronic
917512258 1:175678324-175678346 GTGGGTACAGGGTAGGGCAAGGG - Intronic
917857932 1:179116940-179116962 GAGGCTGAAGGCTGAGGCAGGGG - Intronic
918383923 1:183985772-183985794 GAGGCTCAAGGGAATGGCAGTGG + Intronic
919416698 1:197319386-197319408 CAGGCTGCAGTGTAGTGTAGTGG - Intronic
920056938 1:203199601-203199623 GAGGCTTGAGGGTGAGGCAGGGG + Intergenic
920185532 1:204156875-204156897 AAGGGTGCAGGGGAGGACAGAGG + Intronic
920312494 1:205056819-205056841 CCTGCTGCAGGGCAGGGCAGGGG - Intronic
920315786 1:205074807-205074829 GAGGTTTCTGGGAAGGGCAGAGG + Exonic
920487147 1:206381361-206381383 GAGGCAGGAGGGCAGGGCGGTGG + Intronic
921315711 1:213888322-213888344 GAGGCCTCAGGGAAGGTCAGGGG + Intergenic
922339656 1:224645230-224645252 GAGGGGGCAGAGCAGGGCAGTGG - Intronic
922608706 1:226908302-226908324 GTGCCTTGAGGGTAGGGCAGAGG + Intronic
922775657 1:228213244-228213266 GAGGGTGCAGGGTAGAGGAGTGG - Intronic
922807334 1:228397225-228397247 GAGGCTCCAGGGGCGGGGAGGGG - Intronic
922977229 1:229795268-229795290 CAGGCTGGAGTGCAGGGCAGTGG - Intergenic
922977485 1:229797762-229797784 GGGGCTGGAGGGGTGGGCAGGGG + Intergenic
923268534 1:232334828-232334850 GAGGAGGAAGGGGAGGGCAGGGG - Intergenic
923784705 1:237055640-237055662 GAGGTTTCAGGGGAAGGCAGTGG + Intronic
924052694 1:240093290-240093312 GGGGCTGCCGGGCAGGGAAGCGG - Exonic
924087022 1:240463186-240463208 CAGTCTGCAGGGTATGGCACTGG + Intronic
924527277 1:244863742-244863764 GAGGCCGCGGGGAAGAGCAGCGG - Exonic
1062789013 10:289655-289677 GAGGATGAGGGGTAGGGAAGGGG + Intronic
1062817772 10:513567-513589 CAGGCTGCAGTGTGGCGCAGTGG - Intronic
1062941148 10:1422422-1422444 GGGGCTGCAGGTGAGGGCACAGG + Intronic
1062971009 10:1649407-1649429 GTGGCTGAAGGGCAGGACAGGGG - Intronic
1063084585 10:2804919-2804941 GGGGATGCAGAGTAAGGCAGTGG - Intergenic
1063353108 10:5374212-5374234 GAGGCTGGACGGGAGGGCAGCGG + Exonic
1063385233 10:5612400-5612422 GAGCCTGCAGGGTGGGGAAGTGG - Intergenic
1063866797 10:10373879-10373901 GAGGGTGGAGAGGAGGGCAGAGG + Intergenic
1064018930 10:11793971-11793993 GAGGCTGCAGGGACAGGCCGGGG + Intergenic
1065102600 10:22345626-22345648 GGTGCTGCAAGGTAGGGCCGAGG + Exonic
1065265107 10:23966535-23966557 CAAACTGCAGGGCAGGGCAGGGG - Intronic
1065435839 10:25703106-25703128 GAGGCTGCCGGGTGAGGCTGTGG - Intergenic
1065586178 10:27219221-27219243 GAGGCTGCAGAGGGCGGCAGAGG + Intronic
1065623301 10:27605850-27605872 GAGTGTGCAGGGCAGGGAAGGGG + Intergenic
1065695254 10:28373709-28373731 GAGGCTTCAGGGAGAGGCAGGGG - Intergenic
1067035361 10:42911613-42911635 GAGGCTGGAGCTTAGGGCATAGG + Intergenic
1067068071 10:43114765-43114787 AAGGCAGCTGGGGAGGGCAGGGG - Intronic
1067090662 10:43264513-43264535 GAGTGGGCAGGGGAGGGCAGAGG + Intronic
1067407462 10:46036166-46036188 GAGGCTCCCAGGTAGGGCATGGG - Intronic
1067524581 10:47030426-47030448 GAGGCTGCAGAGAAGGGGTGAGG - Intergenic
1067558250 10:47287095-47287117 CAGGGTGGAGGGTAGGGTAGAGG + Intergenic
1068697377 10:59982224-59982246 GGGGGTGGAGGGGAGGGCAGGGG + Intergenic
1068827040 10:61452358-61452380 GCGGCTGGAGGGAAGGGAAGCGG + Intronic
1068944605 10:62717187-62717209 GAAGCTGCGGGCTGGGGCAGTGG + Intergenic
1068987810 10:63123237-63123259 GAGGGTGGAGGGTAGGGAGGTGG - Intergenic
1069176266 10:65292794-65292816 GATGCAACAGGGAAGGGCAGGGG + Intergenic
1069620704 10:69835642-69835664 GAGGATACAGGGTTAGGCAGTGG + Intronic
1069688685 10:70335430-70335452 GCTGCTGCAGGGCAGGGGAGCGG - Intronic
1069692821 10:70364908-70364930 GCTGCTGCGGGGTGGGGCAGGGG - Intronic
1069779108 10:70943746-70943768 GAAGATGCAGGGTAGGAAAGGGG - Intergenic
1069840585 10:71337083-71337105 CAGGCTGAAGGGGAGGCCAGAGG - Intronic
1069906794 10:71736659-71736681 GAGGCTGCAAGGCAGGGGTGAGG - Intronic
1070129574 10:73647374-73647396 AAGGCTGCAGGGCAGGGGTGGGG - Exonic
1070168333 10:73914208-73914230 GAAGCTGCCCGGTGGGGCAGGGG + Intronic
1070341089 10:75499042-75499064 GAGGCAGGAGGGAAGGGCGGTGG + Intronic
1070574101 10:77664411-77664433 GAGGATGCTGGAAAGGGCAGTGG + Intergenic
1070793800 10:79205292-79205314 GAGGGGCCAGGGCAGGGCAGGGG - Intronic
1070922233 10:80195225-80195247 GAGGCTTCTAGGTAGAGCAGGGG - Intronic
1071434585 10:85635408-85635430 GAGGGGGCAGGGGAGGGCAGGGG - Intronic
1071481435 10:86067885-86067907 GAGGTAGCAGGATGGGGCAGGGG - Intronic
1071573741 10:86711563-86711585 GAGCCTGGAGGGAAGGGGAGCGG - Intronic
1072578971 10:96723525-96723547 CAGGCTGCAGTGCAGTGCAGTGG - Intergenic
1073037850 10:100576602-100576624 GAGGATGAAGGGCAGGGCAGGGG - Intergenic
1073104950 10:101027246-101027268 GAGGGTGGAGGGGAGGGCGGAGG - Intronic
1073190369 10:101646582-101646604 GAGGCAGCCGGGAAGGCCAGGGG + Intronic
1073425024 10:103451137-103451159 GAGGCTGCTGGATAGGAGAGGGG - Exonic
1075226584 10:120634828-120634850 GAGGATGCAGGGAAGGACCGAGG - Intergenic
1075316497 10:121457760-121457782 GAGTCTGCAGGGTGGGGTAAGGG - Intergenic
1075577046 10:123585113-123585135 GAGGCTGGAGGCAGGGGCAGGGG - Intergenic
1076080542 10:127576523-127576545 GAGGCAGCAGGGAAGGGCAAGGG + Intergenic
1076353431 10:129834198-129834220 GAGCCTGCAGGGGAGGGGAGTGG + Intergenic
1076650106 10:131981749-131981771 GAGCCTGCAGGGTGAGGCGGAGG - Exonic
1076888897 10:133274512-133274534 GAGGGTGGAGGGTAGGGAACGGG + Intronic
1076889865 10:133278110-133278132 GAGGCTCCCAGGTAGGGCTGGGG + Intergenic
1076984249 11:223813-223835 GAGGCTGGAGGGCAGGGGAAGGG - Intronic
1076984270 11:223885-223907 GAGGCTGGAGGGCAGGGGAAGGG - Intronic
1076984312 11:224029-224051 GAGGCTGGAGGGCAGGGGAAGGG - Intronic
1077073749 11:690309-690331 GAGAGGGCAGGGGAGGGCAGGGG + Intronic
1077143138 11:1033660-1033682 GTGACTCCAGGGCAGGGCAGCGG + Intronic
1077166862 11:1146139-1146161 GAGGGTCCAGGGGAGGGGAGAGG - Intergenic
1077308604 11:1878676-1878698 CAGGCTGCAGGGTCAGGCAGCGG + Intronic
1077332729 11:1990481-1990503 AGGGCTGCAAGGCAGGGCAGGGG - Intergenic
1077338631 11:2016423-2016445 GAGGCTGCAGGGCAGGGGGCAGG - Intergenic
1077347826 11:2072448-2072470 ATGGCTGCAGGATGGGGCAGAGG + Intergenic
1077376245 11:2206108-2206130 GAGGCTGGAAGGTAGGGGCGTGG - Intergenic
1077383486 11:2258249-2258271 GAGGTCTCAGGGTAGGGAAGTGG - Intergenic
1077466764 11:2737103-2737125 CAGCCTTCAGGGTAGGGCAGCGG + Intronic
1077540174 11:3142973-3142995 GAGCCTGCAGAGCAGGGCAGAGG + Intronic
1078438319 11:11343941-11343963 GTGGCTGCAGGGATGGGAAGAGG - Intronic
1078760139 11:14245176-14245198 GACGCCCCAGGATAGGGCAGTGG + Intronic
1078794520 11:14578704-14578726 AAGGTTGCAGGAGAGGGCAGTGG + Intronic
1078867308 11:15310015-15310037 GAGACAGCAGTGAAGGGCAGTGG + Intergenic
1078891137 11:15560100-15560122 GAAGCGGGAGGGGAGGGCAGAGG + Intergenic
1079444321 11:20545764-20545786 GAGCCTACGGGGAAGGGCAGAGG - Intergenic
1079486079 11:20937197-20937219 AAGGCTGCCAGGAAGGGCAGCGG - Intronic
1081091076 11:38867123-38867145 GAGGCAGCAGGGGAGTGAAGTGG + Intergenic
1081907806 11:46680404-46680426 GAAGCTGCTGGGCAGGGCAGAGG - Intronic
1081960627 11:47134038-47134060 GAGGGTCCAGGGTAGGGGAGAGG - Intronic
1082043538 11:47706631-47706653 GAGGCTGCAGGGTAGGGGTTGGG + Intronic
1082263654 11:50097074-50097096 GTGGCTGCAGGGTAGGGATATGG + Intergenic
1082941197 11:58707114-58707136 GAGGTGGCAGGGTAGTGAAGTGG - Intronic
1083125503 11:60561701-60561723 CAGGCTGTAGTGTAGTGCAGTGG + Intergenic
1083601705 11:63952687-63952709 GAGGCTGTAAGGTCTGGCAGAGG - Intronic
1083602281 11:63956190-63956212 GAGCCAGCAGGGTGAGGCAGAGG - Exonic
1083707427 11:64526005-64526027 GAGGCTGCTGGGGTGGGCTGAGG - Intergenic
1083757335 11:64798755-64798777 GAAGCTGCAGGGGGTGGCAGGGG - Intronic
1083855349 11:65390492-65390514 GAGGCTGCTGGTTGGGGGAGAGG + Intronic
1083955192 11:65978967-65978989 GAGGCTGCAGAGGCGGGCACAGG - Intronic
1084076530 11:66782467-66782489 GAATCTGCAGGGCAGGGCACTGG - Intronic
1084170417 11:67398287-67398309 GAGGCTGCAGCTCAGGGCAACGG - Exonic
1084240537 11:67816896-67816918 GTTGATGCAGGGCAGGGCAGGGG + Intergenic
1084268031 11:68014891-68014913 GGGGCATCAGGGCAGGGCAGAGG + Intronic
1084400928 11:68942459-68942481 GGGGGTGCCGGGCAGGGCAGTGG + Intergenic
1084691135 11:70727488-70727510 GAGGCACCATGGTAGAGCAGGGG + Intronic
1084734195 11:71093946-71093968 GTGGCTGCAGTGTGAGGCAGGGG + Intronic
1084795176 11:71500690-71500712 GAGGGTGGAAGGGAGGGCAGGGG + Intronic
1084918422 11:72449277-72449299 GAGGGAGCAGGATTGGGCAGAGG + Intergenic
1085260737 11:75203250-75203272 GAGGGGGCAGGGTAGGACGGTGG + Intronic
1085274413 11:75289195-75289217 GAGGCTGCAGGGCTGGTCACGGG - Intronic
1085467016 11:76730856-76730878 GAGGCTGGAGGGGTTGGCAGGGG + Intergenic
1085507711 11:77069644-77069666 GAGGCTGCTGGGGAGGGGTGGGG - Intronic
1086097853 11:83068590-83068612 GAGGCTGGAGAGGTGGGCAGAGG - Intronic
1086121779 11:83312130-83312152 GAGGATGCAGGGTTGGGGAGGGG + Intergenic
1087664298 11:101025514-101025536 CAGGCTGTAGTGTAGTGCAGTGG + Intergenic
1088188783 11:107204503-107204525 GAGGATGTAGGATAGGGCAAAGG - Intergenic
1088326441 11:108605876-108605898 GAGGCTGGAGGCCAGCGCAGAGG - Intergenic
1088343728 11:108798742-108798764 CAGGTTGCAGGGTGGGGTAGGGG + Intronic
1088704331 11:112448070-112448092 GAGCCTGCAGGGACAGGCAGGGG + Intergenic
1089103038 11:115980326-115980348 GAGCCTGCAGGGCTTGGCAGGGG - Intergenic
1089376392 11:117998099-117998121 GTGGCTGCAGCGTGGGGCAGTGG - Intronic
1089580514 11:119479015-119479037 GAGGCTCCAGGGAAGAGCACAGG - Intergenic
1089645406 11:119875650-119875672 AGGGCTGCAGGGCATGGCAGGGG - Intergenic
1089967310 11:122664091-122664113 AAGGCTGTAAGATAGGGCAGAGG + Intronic
1090143285 11:124289757-124289779 CAGGGTGCAGGGTAGGGGAAGGG - Intergenic
1090667870 11:128926891-128926913 GGGCCAGCAGGGTGGGGCAGAGG - Intergenic
1090699852 11:129283784-129283806 GAGGCTGGAGGGCTGGGGAGAGG - Intergenic
1090806150 11:130203563-130203585 GAGACTGCACGGACGGGCAGGGG - Intronic
1090916616 11:131169958-131169980 GAGGCAGCTGAGTAGAGCAGGGG + Intergenic
1091194764 11:133721182-133721204 GTGGCTGCAGGCCAGGGAAGTGG - Intergenic
1091220966 11:133929867-133929889 GAGGCTGAAGCGCATGGCAGCGG + Intronic
1202815712 11_KI270721v1_random:45657-45679 AGGGCTGCAAGGCAGGGCAGGGG - Intergenic
1202821615 11_KI270721v1_random:71605-71627 GAGGCTGCAGGGCAGGGGGCAGG - Intergenic
1091563354 12:1630451-1630473 GAGCCAGCAGGGAAGGGCTGTGG + Intronic
1091766412 12:3122970-3122992 GATGCTTCAGGGTTGGTCAGGGG + Intronic
1092142390 12:6192851-6192873 GAGGGTGCTGGGGAAGGCAGGGG + Intergenic
1092154754 12:6274843-6274865 GGGGCTGCAGAGCAGGGCTGAGG - Intergenic
1092230255 12:6772282-6772304 CAGTCTGGAGGGTGGGGCAGGGG + Intergenic
1092258653 12:6940861-6940883 GAGGCTGGAGGGCAGAGAAGAGG - Exonic
1092664843 12:10784401-10784423 GAGGCTGCAGGGTTGGGGAAGGG + Intergenic
1094272964 12:28637677-28637699 GAGGAGGCAGGGCATGGCAGAGG + Intergenic
1094495686 12:30987984-30988006 GCGGCTGCAGGCTGGGGCAGAGG + Intronic
1095437269 12:42204020-42204042 GAGGCTGTAGTGCAGTGCAGTGG - Intronic
1095477037 12:42596159-42596181 GAACCTGCAGAGGAGGGCAGAGG + Intergenic
1095747365 12:45674767-45674789 GAGGCTGGAGAGTTGGGCTGGGG + Intergenic
1095957382 12:47814378-47814400 GAGGCAGCAGGCTAGACCAGAGG + Intronic
1096146520 12:49282587-49282609 CTGGCTGGAGGGGAGGGCAGTGG - Intergenic
1096558810 12:52421593-52421615 GGGGCTCCAGGGGAGGTCAGAGG - Intergenic
1096773591 12:53951135-53951157 AGGGCTGCAGGGTTGGGCGGGGG + Intergenic
1096809690 12:54161447-54161469 CAGGCACCAGGGGAGGGCAGAGG + Intergenic
1097194235 12:57235037-57235059 GAGGCAGTAGGCTTGGGCAGGGG + Exonic
1097203989 12:57304428-57304450 GAGGCAGGAGGATAGGGGAGGGG + Intronic
1097430632 12:59501111-59501133 TAGGGTGAAGGGTGGGGCAGAGG - Intergenic
1098465756 12:70784073-70784095 GTGGCTGCAGCTGAGGGCAGAGG + Intronic
1099145286 12:79035753-79035775 GAGTCTGCAGGGGTGAGCAGGGG - Intronic
1099385280 12:82006175-82006197 GAGGGAGCAGGGGAGGGGAGGGG + Intergenic
1100187250 12:92151427-92151449 AAGGCTGCGGGGTAGGGGTGGGG - Intergenic
1100345225 12:93723516-93723538 GAGGCAGCAGGGTCGGGAATAGG - Intronic
1100584201 12:95964306-95964328 GAGGGTTCAGGGGAGAGCAGGGG - Intronic
1100829359 12:98503807-98503829 GCGGCTGGAGGCAAGGGCAGAGG - Exonic
1101141929 12:101804481-101804503 TTGGCTGCAGAGTAGGGCACTGG - Intronic
1101179023 12:102190449-102190471 GGGGTTTCAGGGTAGGCCAGTGG - Intronic
1101374230 12:104157083-104157105 GAGGCCACAGGGCTGGGCAGAGG - Intergenic
1101727704 12:107401960-107401982 GAGGCTTCTGAGGAGGGCAGAGG - Intronic
1101849644 12:108391991-108392013 CTGGCTGCAGGGTAGAGCACAGG + Intergenic
1102027640 12:109722656-109722678 CAGGCAGCAGGGTAGGGGAGTGG - Intronic
1102060005 12:109924965-109924987 GATTCTGAAGGGAAGGGCAGTGG + Intronic
1102260258 12:111439010-111439032 CAGGCTGCAGTGCAGTGCAGTGG + Intronic
1102316748 12:111894390-111894412 AAGGCTGCAGGGAAGGGGAAAGG - Intronic
1102554912 12:113720561-113720583 GAGGCTGCAGGGGAGGACTGGGG - Intergenic
1102975995 12:117207629-117207651 GAGGCAGAAGTGAAGGGCAGGGG - Intergenic
1102989331 12:117303520-117303542 GAGGCTGGAGGGAGGGGCAAGGG + Intronic
1103201316 12:119090356-119090378 GAGGAAGCAGGATAGGACAGGGG + Intronic
1103487268 12:121291609-121291631 GGGGCTGCAGGGAGGGGCACTGG + Intronic
1103739006 12:123078703-123078725 GAGGCTGCTGGGCACAGCAGGGG + Intronic
1103749367 12:123149194-123149216 GAGGCAGCAGGGGAGAGAAGTGG - Intronic
1103846099 12:123902920-123902942 TCGGCTGCAGGGTAGGACAGGGG - Exonic
1103860368 12:124007487-124007509 GTGGCTGCAGGCGAAGGCAGTGG - Intronic
1103962336 12:124617029-124617051 GAGGCGGGAGGGGAGGGCGGAGG - Intergenic
1103999152 12:124849343-124849365 GAGGCTGCAGGGGTGTGCCGTGG - Intronic
1104544249 12:129696908-129696930 GAAGCAGCAGGGTAGAACAGAGG + Intronic
1104679489 12:130739675-130739697 GAGGATGCTGGGGTGGGCAGGGG - Intergenic
1104856211 12:131903649-131903671 GGGGCTGCAGGGTAGGGTGGGGG - Intronic
1104893567 12:132151468-132151490 GAGGTGGCTGGGCAGGGCAGTGG - Exonic
1105636482 13:22220533-22220555 GGGGCTGCAGGGAGGGGCTGGGG - Intergenic
1105967641 13:25399154-25399176 GGGACTGCTGGGTATGGCAGTGG + Intronic
1107376435 13:39809733-39809755 AAGGCTACATGGTAAGGCAGAGG + Intergenic
1107657139 13:42603334-42603356 GGGACTGAAGTGTAGGGCAGGGG + Intronic
1108682786 13:52793765-52793787 GATGCTGCAGAGCAGAGCAGCGG - Intergenic
1113092514 13:106630324-106630346 GAAGAAGCGGGGTAGGGCAGGGG + Intergenic
1113257651 13:108524258-108524280 GAGGCTGGAGTGGAGTGCAGTGG - Intergenic
1113490886 13:110690804-110690826 GACCCTGCAGGTGAGGGCAGAGG - Intronic
1113724423 13:112587790-112587812 GAGGATGCAGGGCCGGGCAGAGG - Intronic
1113873816 13:113582212-113582234 GAGACTGCAAGGCAAGGCAGTGG + Intergenic
1113889175 13:113726997-113727019 GAGGCCGCAGGCTGGGGCATGGG - Intronic
1114203932 14:20550061-20550083 GAGGTCACAGGGGAGGGCAGAGG - Intergenic
1114264031 14:21060737-21060759 GAGGCTGCAGGAGAAGGGAGGGG - Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1114815592 14:25954366-25954388 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
1115706002 14:35998774-35998796 GAGGTCGCTGGGTAGGACAGAGG - Intergenic
1116898569 14:50340483-50340505 GAGGCGGAGGGGAAGGGCAGGGG - Intronic
1117130911 14:52686170-52686192 GAGGCTGGAGTGCAGTGCAGTGG - Intronic
1117230125 14:53708332-53708354 GAGGCTGCAGATAAAGGCAGAGG + Intergenic
1117491938 14:56256779-56256801 GAGCATGCAGGGTAGAGGAGAGG - Intronic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1118816591 14:69318390-69318412 AAGGCAGCAGGCTGGGGCAGGGG + Intronic
1119440218 14:74623190-74623212 GAGGCTGGAGGGGAAGGCTGGGG + Intergenic
1119484886 14:74980834-74980856 GGGTCTGCAGAGTAGGGGAGGGG - Intergenic
1119869647 14:78005512-78005534 AAGCCTTCAGGGTGGGGCAGTGG - Intergenic
1120003853 14:79334502-79334524 GAGCCCGCAGGGCAGGACAGGGG + Intronic
1120039810 14:79739602-79739624 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1120989534 14:90363031-90363053 GATGCTGCAGGCTGGGACAGGGG - Intergenic
1121007769 14:90501190-90501212 GGGGCTGCAGGGCCGGGAAGTGG - Intergenic
1121015367 14:90545733-90545755 GGGGCTGCAGGGTATGGGACAGG + Intronic
1121465297 14:94111811-94111833 GAGGCGGCTGGGAAGGGCGGGGG + Intronic
1121642792 14:95497082-95497104 GAGGCTCCAGGGCTGGGCTGAGG + Intergenic
1121642890 14:95497981-95498003 CAGGCTGGAGGGGAGTGCAGTGG - Intergenic
1121855588 14:97266597-97266619 GAGTCTGCAGTGTAGGAGAGGGG - Intergenic
1122115888 14:99527020-99527042 GAGGATGCAGGACAGGGCAGGGG + Intronic
1122314903 14:100820205-100820227 CAGGCAGCAGTGGAGGGCAGCGG + Intergenic
1122785764 14:104162671-104162693 GGGGCTGCAGGGGAGGGTGGAGG + Intronic
1122825575 14:104368915-104368937 GGGGCTGCATGGAGGGGCAGTGG + Intergenic
1122908844 14:104816429-104816451 GCGGCCGCAGGGCCGGGCAGAGG + Intergenic
1122960162 14:105090551-105090573 AGGGCTGCAGGCCAGGGCAGAGG - Intergenic
1124064092 15:26323396-26323418 GAGACTGCAGGAGAGGACAGAGG + Intergenic
1124584294 15:30991391-30991413 GAGGCTCCACGGAAGCGCAGAGG + Intronic
1124811632 15:32944788-32944810 GAGGGGGGAGGGTAGGGCTGTGG + Intronic
1124881062 15:33643212-33643234 GAGGCTGCTGGATGAGGCAGGGG - Intronic
1125758490 15:42081801-42081823 GAGGCTGCAGCTCAAGGCAGAGG - Exonic
1126011619 15:44308218-44308240 CAGGCTGGAGGGAAGGGCAATGG - Intronic
1126585299 15:50280200-50280222 GAGGCAGCAGGATAGGGCCTGGG - Intronic
1126810683 15:52400324-52400346 GAGGGGGCAGGGTAGGGGACTGG + Intronic
1127029598 15:54847351-54847373 AAGGCTGCAGAGAAGGGCACAGG - Intergenic
1127260377 15:57322996-57323018 GAGTCTGGAGGGGAGGCCAGGGG - Intergenic
1127783826 15:62339056-62339078 GAGGCTGCAGTAGAAGGCAGAGG - Intergenic
1128029445 15:64466824-64466846 AAGTCTTCAGGGTAGGGAAGTGG - Intronic
1128211896 15:65909005-65909027 GGGGGTGGAGGGTAGGGCTGGGG + Intronic
1128520599 15:68372322-68372344 GAGGCTGCAGGGGGTGGCAGGGG - Intronic
1128647428 15:69387824-69387846 CAGCCTGCAGGGAAGGGAAGAGG - Intronic
1128762553 15:70227314-70227336 GAGGGAGCAGGGCAGGGCTGGGG - Intergenic
1129160425 15:73744538-73744560 GAGGCACCAGGGAAGAGCAGTGG - Intronic
1129177878 15:73853012-73853034 GAGGAAGCAGGATTGGGCAGAGG - Intergenic
1129265183 15:74389501-74389523 GAGGCAGGAGGGGAGGGCAAGGG + Intergenic
1130063803 15:80588546-80588568 AAGGCTGGAGGGTAAGCCAGGGG - Intronic
1130570601 15:85039924-85039946 GAGGCTGGAGGGTAGGGGAGTGG + Intronic
1130610926 15:85360292-85360314 GAGGCTGGAGAGTTGGACAGGGG + Intergenic
1130957710 15:88639136-88639158 CAGGCTGCGGGGCAGGCCAGAGG + Intronic
1130975151 15:88768231-88768253 GGGGCTGCATGGCAGGGGAGGGG + Intergenic
1131151440 15:90049740-90049762 TTGGCTGCAGGGTAGAGGAGAGG - Intronic
1131372452 15:91894221-91894243 GAGGTTGGAGAGGAGGGCAGGGG + Intronic
1131429758 15:92377409-92377431 GAGGCAGCAGGTTTGGGCAAAGG - Intergenic
1131528107 15:93168227-93168249 CAGCATGCAGGGTAGAGCAGGGG - Intergenic
1131711238 15:95059025-95059047 GAGGTGGCAGGGTAGTGAAGTGG + Intergenic
1131872578 15:96777274-96777296 GAGCCTGCAGGGCAGGGCTGTGG + Intergenic
1132150455 15:99454855-99454877 GTGGGTCCTGGGTAGGGCAGAGG - Intergenic
1132238918 15:100242555-100242577 GAGGCTGCAGTGTGTGGGAGAGG - Intronic
1132253729 15:100355546-100355568 GAGGGAGCAGGGGAGTGCAGTGG - Intergenic
1132359715 15:101202126-101202148 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1132359731 15:101202189-101202211 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359745 15:101202252-101202274 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359761 15:101202315-101202337 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359775 15:101202378-101202400 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359799 15:101202504-101202526 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1132359815 15:101202567-101202589 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359829 15:101202630-101202652 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132410786 15:101577063-101577085 GAGGCTGCTGGGAAGGGCTGGGG - Intergenic
1132480774 16:165191-165213 GAGGGTGAAGGGCAGGGGAGGGG - Intronic
1132667881 16:1090269-1090291 GAGGCAGCAGGCTTGGGCAGTGG + Exonic
1132671398 16:1103514-1103536 GAGGCTGCAGGTCAGGGGCGGGG + Intergenic
1132689002 16:1174161-1174183 GAGTCTCCAAGGAAGGGCAGAGG + Intronic
1132710514 16:1264193-1264215 GAGGCTGTAGGGTTGGGCCTCGG - Intergenic
1132808145 16:1785212-1785234 GAGCCTGCCGGGTGGGGCAGTGG - Intronic
1132891667 16:2207803-2207825 GAGGCTGGAGAGAAGAGCAGGGG - Intronic
1133072252 16:3254413-3254435 GAGGCTGCAGGGGCTGGCGGGGG - Exonic
1133221402 16:4320621-4320643 GACGATGCAGGGAAGGGGAGAGG - Intronic
1133236729 16:4390849-4390871 GAGGCAGCAGGGAAGGGAGGAGG + Intronic
1133336311 16:5008765-5008787 GACCCTGCAGGACAGGGCAGAGG + Intronic
1133623148 16:7545479-7545501 AAGGCTGCAGGGAAGGTCGGGGG - Intronic
1133787856 16:8986861-8986883 GAGGATGCAGAGAAGTGCAGAGG - Intergenic
1134034633 16:11020421-11020443 GAGGCAGCATGGTCGGGCTGAGG - Intronic
1134084585 16:11347644-11347666 AAGGCTGATGGGTAAGGCAGTGG - Intronic
1134157554 16:11856006-11856028 CAGGCTGGAGTGTAGTGCAGTGG + Intergenic
1134317712 16:13134625-13134647 GAGGCTGGAGAGATGGGCAGGGG + Intronic
1134470340 16:14519336-14519358 GAGGGTGGAGGGGAGGGGAGGGG + Intronic
1135136867 16:19891453-19891475 CAGGTGGCTGGGTAGGGCAGTGG - Intergenic
1135294608 16:21268400-21268422 GGGGTTGGAGGGTGGGGCAGCGG + Intronic
1135343647 16:21669439-21669461 GAGCCTGCAGGTTAGGGGAGAGG - Intergenic
1135468925 16:22712107-22712129 AAGGCTGCAGGGTAGGTGGGGGG + Intergenic
1135709273 16:24701219-24701241 GAGGCTGCAGGGGACTGCAGGGG + Intergenic
1136619188 16:31416680-31416702 GGGGCTACAGGGCAGGGGAGAGG - Intronic
1137594250 16:49713468-49713490 GGTGCAGCAGGGCAGGGCAGAGG - Intronic
1137726084 16:50657663-50657685 GAGGCTGCAGGCAAGGGCAGAGG - Intergenic
1138201402 16:55091391-55091413 GAGGCTGCAGGGCAGAGCCAGGG + Intergenic
1138878826 16:60986026-60986048 GAGGCTGGAGGGTAGGAGAAGGG - Intergenic
1139545758 16:67648802-67648824 GAGGCGGAAGGGCAGGGCCGTGG + Intronic
1139563914 16:67761005-67761027 GAGCTGGCAGGGAAGGGCAGAGG - Intronic
1139665669 16:68453806-68453828 GAGGCTGTAGGGTAGTGGTGGGG + Intergenic
1140128388 16:72136663-72136685 GGGGCTGCAGGCTGTGGCAGGGG - Intronic
1140129772 16:72150259-72150281 GAGGAAGCAGGGTTGGGCAGAGG + Intronic
1140628062 16:76818578-76818600 GATCCTGCAGGGAAGGGAAGAGG - Intergenic
1140818044 16:78638644-78638666 CAGGCTGGAGGGAAGGGCGGGGG + Intronic
1141873509 16:86805961-86805983 GAGGCTGCAGGGTTGGCCTATGG + Intergenic
1141926193 16:87171187-87171209 GAGGCTGCATGGTGGGGGATGGG + Intronic
1141992324 16:87617645-87617667 GGGGCTGCATGGTAGGGCAGAGG + Intronic
1142129919 16:88427788-88427810 AAGGCTGGCGGGCAGGGCAGAGG + Exonic
1142747439 17:1966934-1966956 GAGGATGCTGGGAAGGCCAGGGG - Intronic
1143019814 17:3911542-3911564 GAGGCCGCAGGGATGGGAAGGGG - Intronic
1143113808 17:4569439-4569461 GGAGCTGGAGGGTAGAGCAGTGG + Intergenic
1143139573 17:4733733-4733755 GAGGATGCAGGAGAGGGCTGAGG + Exonic
1143347638 17:6261697-6261719 GACGCTGAAGGGAAGGACAGTGG + Intergenic
1143506254 17:7367228-7367250 GAGCCTGCGGGGCAGGGCAGAGG + Intergenic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1143739553 17:8942336-8942358 GAGGCTGCAGGGTGGGGGCAGGG - Intronic
1144092393 17:11869740-11869762 AAGTCTGCAGGTCAGGGCAGCGG + Intronic
1144574979 17:16423680-16423702 CAAGCTGCACGGTAGGGCAGAGG - Exonic
1144589943 17:16515381-16515403 GAGGCTGGAGAGATGGGCAGGGG - Intergenic
1144760091 17:17702228-17702250 GAGGCTGGAGAGGTGGGCAGAGG + Intronic
1145107776 17:20134358-20134380 GAGGCTGGAGGGTGGGGAATGGG - Intronic
1145864134 17:28229170-28229192 GAGGCTGGAGGGCAGCACAGGGG - Intergenic
1145903070 17:28500365-28500387 GAGGCTGCAGGGTTGGAGACTGG - Intronic
1146465235 17:33081021-33081043 GAGGCTGCAAGGTAGTGGGGAGG + Intronic
1146622671 17:34411740-34411762 GAGGGTGATGGGTTGGGCAGAGG - Intergenic
1146628825 17:34455509-34455531 GAGGCTGCAGAGGCGGGCAGGGG + Intergenic
1146762066 17:35487501-35487523 GAGGCTGGAAGGTTTGGCAGTGG + Intronic
1147168437 17:38605249-38605271 GAGGATGCAGGGGAGGGGAAGGG - Intronic
1147244446 17:39110899-39110921 GAGGCAGGAAGGGAGGGCAGTGG - Intronic
1147311213 17:39597074-39597096 TGGGCTGTAGGGTGGGGCAGAGG - Intergenic
1147314984 17:39615766-39615788 GATGCTGCAGCGCAGGGCAGTGG + Intergenic
1147466588 17:40615625-40615647 GGGGCTGGAGGGAAGGGCTGAGG + Intergenic
1147703463 17:42410310-42410332 GAGGGTGCAGAGGAGGGGAGAGG + Intronic
1147758646 17:42783838-42783860 GCGGCAGCAGGGTGCGGCAGGGG + Intronic
1147926710 17:43951077-43951099 GAGGCTGGAGGGCAGCACAGGGG + Intergenic
1148094855 17:45045271-45045293 GAGGCTACAGGATAAAGCAGGGG - Intronic
1148622329 17:49043886-49043908 GAGGATGCAAGGCAGGGGAGTGG + Intronic
1149160484 17:53687135-53687157 GAGCCTGCAGGGAAGGGGTGTGG + Intergenic
1149488281 17:57062407-57062429 GAGGCTGGAGTGCAGTGCAGTGG + Intergenic
1150209932 17:63436370-63436392 GAGGTTGGAGGGTGGGGGAGGGG - Intronic
1150285286 17:63950633-63950655 GATGGTGCAGGGGTGGGCAGGGG + Intronic
1150577577 17:66443734-66443756 GAGGATGGAGGAAAGGGCAGGGG + Intronic
1150765398 17:67997953-67997975 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1150934939 17:69625058-69625080 CAGGATGCTGGGTTGGGCAGCGG + Intergenic
1151349298 17:73522277-73522299 GTGGCTGCAGCCTGGGGCAGGGG - Intronic
1151354530 17:73550589-73550611 GAAGCTGCAGGGTAGGGGTGGGG - Intronic
1151450123 17:74193686-74193708 CAGGCTCCTGGGGAGGGCAGAGG - Intergenic
1151656758 17:75499776-75499798 AAGGCTGCCGTGGAGGGCAGGGG + Exonic
1151713602 17:75820201-75820223 TAGGCTGGGGGTTAGGGCAGAGG + Intronic
1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG + Intronic
1151756933 17:76080439-76080461 GGGGCTGCAGGGTTGAGGAGGGG + Intronic
1152032440 17:77852826-77852848 GAGGCGGCAGGGCAGAGCCGCGG + Intergenic
1152101787 17:78305744-78305766 GAGGCTGCAGGGGCTGGAAGAGG - Intergenic
1152234858 17:79133230-79133252 GAGGCTGCAGGGGAAACCAGAGG + Intronic
1152355972 17:79807490-79807512 CAGGGGGCAGGGCAGGGCAGAGG + Intergenic
1152538405 17:80963220-80963242 GCGAGTGCAGGGTGGGGCAGGGG - Intronic
1152571697 17:81123901-81123923 GAGGCTGCAGAGTGAGACAGAGG + Intronic
1152608563 17:81304844-81304866 GATGCCGCAGGGGACGGCAGAGG - Intergenic
1153282319 18:3425956-3425978 GCGGGGGCAGGGCAGGGCAGGGG - Intronic
1153598233 18:6751024-6751046 GAGGCTGCAGTCCAGTGCAGGGG - Intronic
1153807685 18:8723671-8723693 GAAGGTGCAGGGTGGGGCAAGGG - Intronic
1153934032 18:9904899-9904921 GAGGCTGCAGGGAAGGAGAGGGG - Intergenic
1153935868 18:9920736-9920758 GAGGCTGGAGAGTTAGGCAGTGG - Intronic
1154082980 18:11276326-11276348 AAGGAAGCAGGATAGGGCAGAGG + Intergenic
1154250059 18:12736941-12736963 GGCGCTGCAGGGTACAGCAGAGG + Intergenic
1155072531 18:22329099-22329121 GAGGCTGGAGAGGAAGGCAGAGG + Intergenic
1156136733 18:34049158-34049180 GAGGTTTCAGGGTGGGGGAGGGG + Intronic
1156479031 18:37424682-37424704 GAACCTGCAGGGAAGGGCAGTGG - Intronic
1156970450 18:43147860-43147882 CAGGCTGGAGTGCAGGGCAGTGG - Intergenic
1157239083 18:45992760-45992782 CAGGCTGCAGTGCAGTGCAGTGG + Intronic
1157592257 18:48842982-48843004 CAAGCAGAAGGGTAGGGCAGGGG - Intronic
1158097696 18:53793077-53793099 GAGGCAGCAGGGGAGTACAGTGG - Intergenic
1158934850 18:62354833-62354855 GAGCCAGCAGGATAGTGCAGGGG + Intronic
1159187947 18:65003012-65003034 GAGGAGGTAGGGTAGGTCAGTGG - Intergenic
1159541993 18:69789895-69789917 GAGGCTGCAGTGTAAGTCTGTGG + Intronic
1159725605 18:71953805-71953827 CAGGCTGCAGTGCAGCGCAGTGG + Intergenic
1160135033 18:76264550-76264572 CAGGGTGGAGGGCAGGGCAGAGG + Intergenic
1160372269 18:78383698-78383720 GAGGCTGCAAGGCTGGGCAGTGG - Intergenic
1160462296 18:79048335-79048357 TAGGCTGCAGAGAAGGCCAGGGG + Intergenic
1160558077 18:79739057-79739079 GGGTCTTCAGGGGAGGGCAGTGG - Intronic
1160590903 18:79944185-79944207 GAGGCTGCAGGGAGGGCCTGGGG - Intronic
1160668568 19:344855-344877 GAGCCTGGAGGGCGGGGCAGGGG + Intergenic
1160722865 19:604909-604931 AGGGCTGCAGGGTGGGGCGGGGG + Intronic
1160927448 19:1553720-1553742 CAGGCTGCAGGCTTGGGGAGTGG - Intergenic
1160928802 19:1560067-1560089 GAGGCTGGAGGATGGGGCTGGGG + Intronic
1161083937 19:2325311-2325333 GAGCCTGCAGGGCAGTGGAGGGG - Intronic
1161130568 19:2586234-2586256 AAAGCTGGAGGGTGGGGCAGTGG - Intronic
1161296511 19:3523108-3523130 GAGGCTGCTGGCCAGGGCAGAGG - Intronic
1162018666 19:7858773-7858795 GAGCCAGCAGGGTGGGGCTGAGG + Intronic
1162175117 19:8824604-8824626 GAGGCAGAAGGGTGGGGCACAGG - Intronic
1163004452 19:14388824-14388846 GAGGCTTGAGGGCAGCGCAGGGG + Intronic
1163018659 19:14471562-14471584 GAGTCTGCAGGGGAGGGAAGCGG - Exonic
1163063009 19:14773910-14773932 GAGGCTTGAGGGCAGCGCAGGGG - Intronic
1163133290 19:15290052-15290074 TAGGCTTAAGGGTAGGGCAGGGG + Intronic
1163225301 19:15956492-15956514 GAGGGTGCAGGGGAAGGAAGGGG - Intergenic
1163455445 19:17403572-17403594 GAGGCTGCAGGGGAAGGGACTGG - Intronic
1163491665 19:17620499-17620521 GGGGTTGGTGGGTAGGGCAGAGG - Intronic
1163523898 19:17808548-17808570 GAGGCTAGGGGGAAGGGCAGAGG + Intronic
1163751967 19:19083543-19083565 GACGCTGCTGGGCAGGGCAGGGG - Intronic
1163849878 19:19656777-19656799 GAGGCAGGAGGGTTGGCCAGAGG + Intronic
1164593219 19:29517566-29517588 GGGGCTCCACGGTAGGGCACAGG - Intergenic
1164634118 19:29780231-29780253 GAGGCTGGAGCTGAGGGCAGAGG - Intergenic
1164802622 19:31090301-31090323 GAGGTTCCAGGGAAGGGTAGGGG - Intergenic
1165080371 19:33302997-33303019 GAGGCTGCAGCGCAGAGCAGCGG + Intergenic
1165099325 19:33429150-33429172 GAGGGGGCAGAGTTGGGCAGTGG + Intronic
1165196701 19:34109701-34109723 GAGGCTGTTGGGTATGACAGTGG - Intergenic
1165421573 19:35724674-35724696 CAGGCTGCAGGGTAGGTTTGCGG - Exonic
1165477688 19:36040698-36040720 GAGGCTGGAAGGAGGGGCAGTGG - Intronic
1165758804 19:38308950-38308972 GAGGGTGCAGGGTAGGGGGAGGG + Intronic
1165792902 19:38502739-38502761 CAGGCTTCAGGGTGGGGCAGGGG + Intronic
1166037495 19:40179622-40179644 GTGATTGCAGGGTAGGACAGAGG - Intergenic
1166164509 19:40977903-40977925 GGGGCTCCAGGGATGGGCAGAGG - Intergenic
1166306086 19:41937840-41937862 GAGGCCACAGGGCAGAGCAGTGG + Intergenic
1166308900 19:41951470-41951492 GAGGCAGCAGGCTAGAGCTGCGG - Intergenic
1166365576 19:42276742-42276764 GGGGGTGAAGGGTAGGGGAGTGG - Intronic
1166380073 19:42351120-42351142 CAGTCTGCAGGGTGGGGCAGGGG + Intronic
1166380781 19:42354073-42354095 GAGGATGCAGGCTGGGTCAGGGG - Intronic
1166704827 19:44903011-44903033 GAGCCTGCAGGGAAGAGCTGAGG - Exonic
1166708049 19:44919417-44919439 GGGTCTGCAGGAGAGGGCAGGGG + Intergenic
1166785574 19:45364810-45364832 GAGGCTGGTGGGATGGGCAGAGG - Intronic
1166801610 19:45461167-45461189 GAGGCTCCAGAGGAGGGGAGGGG - Intronic
1167044050 19:47039646-47039668 GGGTCTGCAGGATAGGGCACTGG + Intronic
1167049957 19:47072150-47072172 GAAGCTGCCGAGGAGGGCAGTGG + Intronic
1167265492 19:48480939-48480961 GCGGCGGGAGGGGAGGGCAGAGG + Intronic
1167348733 19:48962456-48962478 GAGGCTGGAGGGCAGGGCAGAGG + Intergenic
1167535770 19:50050566-50050588 GAGGCTGCAGGGGTGGGGACGGG - Intronic
1167625079 19:50582711-50582733 GAATTTGCAGGATAGGGCAGTGG + Intergenic
1167665517 19:50821072-50821094 GAGGGTGCTGGGAAGGGAAGGGG - Intronic
1167768526 19:51499856-51499878 AGGGCCGCAGGGTAGGGCTGAGG - Intronic
1168029002 19:53664955-53664977 GAGGATGAAAGGCAGGGCAGGGG - Intergenic
1168237410 19:55071970-55071992 GGGGCTGCAGGGGTGGCCAGCGG - Intergenic
1168327340 19:55545031-55545053 CAGGATGGAGGGTGGGGCAGGGG + Intronic
1168405016 19:56106126-56106148 GAGGCTGCAGGGCGCGGCGGGGG - Intronic
1168602111 19:57726527-57726549 GGGACTGCAGGGCAGGGAAGAGG - Intronic
925051353 2:818181-818203 GAGACTCCAGAGTAGGCCAGGGG + Intergenic
925130085 2:1488507-1488529 GAGGCTGCCGGGTGGGGCCTGGG - Intronic
925507509 2:4584350-4584372 TTGGCTGCAGGGTAGGGGAGCGG - Intergenic
925526608 2:4809691-4809713 TGGGCTGGAGGGTAGGGGAGTGG + Intergenic
925812495 2:7714071-7714093 AAGGCTGCTGGGCAGGACAGAGG - Intergenic
925933676 2:8732763-8732785 GAGTGGGCAGGGCAGGGCAGCGG - Intronic
925976725 2:9146882-9146904 GAGGCTGCAGGGGAAGGCGGGGG - Intergenic
926575895 2:14580950-14580972 GAGGCTGGAGGGTGGGGTAATGG - Intergenic
926822737 2:16871156-16871178 GAGGGTGGAGGGTTGGGAAGAGG - Intergenic
927701210 2:25270077-25270099 GTGGCTGGAAGGTGGGGCAGGGG - Intronic
927940505 2:27100309-27100331 CAGGCTGGTGGGCAGGGCAGAGG - Exonic
928436288 2:31256759-31256781 GAAGCTGCAGAGAAGGGAAGAGG - Intronic
929414115 2:41730012-41730034 GAGGCTGCAGGGTAGGGCATTGG - Intergenic
930247922 2:49003861-49003883 GAGGAGGCAGGGCAGGGCAGTGG - Intronic
930574248 2:53126971-53126993 GAGGTAGCAGGGTAGTGAAGTGG + Intergenic
931218844 2:60270848-60270870 GAGGCTGGAGGGGGCGGCAGTGG + Intergenic
931670440 2:64642642-64642664 GAGCCTGCAGGTTAAAGCAGTGG - Intronic
931804454 2:65790482-65790504 GAGGCTGGAGGGCTGGGCTGGGG + Intergenic
931828596 2:66027172-66027194 GAGGCTGAGGGGTAGTGGAGGGG - Intergenic
931977491 2:67658664-67658686 GATGCTGCAGAGAAGGGTAGAGG - Intergenic
932598121 2:73106898-73106920 GAAGCTGCAGGGTGGGGAGGGGG - Intronic
932843488 2:75109103-75109125 AAGGCTGCAGGGTGGAGCTGAGG + Intronic
932967017 2:76488487-76488509 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
933719354 2:85387620-85387642 CAGGCTGGAGTGCAGGGCAGTGG - Intronic
933791617 2:85888336-85888358 GAGGGTGCAGGGAAGGTCACCGG + Intronic
933803710 2:85982895-85982917 GATGGTGCAGGTGAGGGCAGAGG - Intergenic
935341804 2:102065528-102065550 GGGGCTCCAGGCTAAGGCAGTGG - Intronic
935364899 2:102278903-102278925 TAAGCTGCAGGGTGAGGCAGGGG - Intergenic
935540393 2:104341128-104341150 GAGGTTGCAGGTTAGTTCAGAGG + Intergenic
935675977 2:105595311-105595333 GAGGATGGAGGGCAGGCCAGTGG - Intergenic
935946337 2:108289808-108289830 GAGGCAGCTGGGTAGTGCAGTGG - Intronic
936152338 2:110028673-110028695 GAGCCGGCAGGGCAGGGCTGTGG + Intergenic
936155513 2:110044068-110044090 GGGGCTGCAGGGTCGGCCAAGGG + Intergenic
936189173 2:110327366-110327388 GGGGCTGCAGGGTCGGCCAAGGG - Intergenic
936192341 2:110342739-110342761 GAGCCAGCAGGGCAGGGCTGTGG - Intergenic
936701113 2:115012427-115012449 GAGGCAGCAGGGGAGTGAAGTGG - Intronic
936940620 2:117880426-117880448 GAGGCTGGAGGGTAGGGGGTAGG - Intergenic
937145171 2:119638454-119638476 TGGGCTGCAGGGAGGGGCAGGGG + Intronic
937768801 2:125694894-125694916 GAGTCTGCTGCCTAGGGCAGGGG - Intergenic
937796451 2:126027869-126027891 CAGGCTGGAGTGTAGTGCAGTGG - Intergenic
938359027 2:130673892-130673914 GGGGTTGCAGGGAAAGGCAGAGG + Intergenic
938380862 2:130835878-130835900 GAGGGTGCAGGCTTGAGCAGGGG + Intergenic
938791283 2:134678579-134678601 GAGGCTGAAGGTCAGAGCAGAGG + Intronic
941032766 2:160532058-160532080 GAGCCTGTAGGGTGGGGCGGGGG + Intergenic
941317832 2:164017045-164017067 GAGGCTGCCTGGTAGGTCAATGG - Intergenic
941366993 2:164621483-164621505 GAGGCGGCGGGGGAGGGGAGGGG + Exonic
941738293 2:169005048-169005070 GAGGCAGCAGGGGAGTGAAGTGG + Intronic
941862539 2:170298632-170298654 GAGGCTGGAGTGCAGAGCAGTGG - Intronic
943046267 2:182866032-182866054 GAGGCTGTAGGGTAAGGGAAGGG + Intronic
943293127 2:186101392-186101414 CAGGCTGGAGGGCAGTGCAGTGG - Intergenic
944208322 2:197180481-197180503 GAGGCTGCAGGGAATGGCGGTGG - Intronic
944423288 2:199553811-199553833 TAGGCTGGAGGGCAGTGCAGTGG - Intergenic
945385879 2:209200606-209200628 GAGGCTGAAGGGAAGGGTATGGG - Intergenic
945982079 2:216320550-216320572 GAGGCTGCATAATAGGGTAGTGG - Intronic
946140454 2:217686101-217686123 GGGGCTGGAGGGTAGAGGAGCGG - Intronic
946966573 2:225042757-225042779 CAGGCTGCGGGGGAGGGCGGGGG + Intergenic
947003745 2:225487307-225487329 GAGGCTCGAGGCTACGGCAGAGG - Intronic
947152659 2:227130920-227130942 GAGTGTGGAGGGTAGGGAAGTGG - Intronic
947633204 2:231666655-231666677 GAGGCTGCTGGGGAGGGCCAGGG + Intergenic
948027359 2:234788961-234788983 GAGGCAGTAGGGATGGGCAGTGG - Intergenic
948251874 2:236536014-236536036 GAGGATGGTGGGGAGGGCAGTGG + Intergenic
948287596 2:236798578-236798600 GAGGAAGCAGGATTGGGCAGAGG + Intergenic
948317075 2:237036163-237036185 GGGGCAGCAGGGCAGGGCGGAGG - Intergenic
948359977 2:237413115-237413137 GAGGATGCAGGGTGGGGCTCGGG - Intronic
948603344 2:239119866-239119888 GAGGCAGCAGGGCCGGGCAGAGG + Intronic
948850419 2:240702848-240702870 GAGATTTCAGGGGAGGGCAGGGG - Intergenic
948920473 2:241063854-241063876 GAGGGTGCTGGGGAGGGCTGAGG + Intronic
1168827516 20:823546-823568 CAGGCTGCAGTGTTGGGGAGGGG + Intergenic
1168830222 20:841599-841621 GAGGCCGCGGGGCAGGGCTGGGG - Intronic
1168830891 20:844842-844864 CAGGCGGCAAGGTAGGGCGGGGG - Exonic
1168848323 20:959967-959989 AAAGCTGCAGGGGAGGGCACAGG + Exonic
1168959302 20:1857749-1857771 GAGGCTGCAGGTTGGGGGTGGGG + Intergenic
1169066837 20:2698522-2698544 GTGCCTGCAGGGGAGAGCAGGGG + Intronic
1169902250 20:10565459-10565481 GTCTCTGCAGGGTGGGGCAGAGG - Intronic
1170907521 20:20529087-20529109 GAGGCAGGAGAGGAGGGCAGTGG + Intronic
1171046599 20:21813977-21813999 GAGGCTGGAGGGGAAGGCAGGGG - Intergenic
1171238694 20:23548070-23548092 GAGGCTGCTGGCTAGGGAGGAGG - Intergenic
1171302752 20:24078120-24078142 GAGGCTGCTGAGTAGAGAAGAGG + Intergenic
1171348376 20:24483973-24483995 GAGGGTGCAGGATAGGGCAGAGG + Intronic
1171351870 20:24508790-24508812 GCGCCTGCAGGGTAGTGGAGTGG - Intronic
1171389806 20:24794291-24794313 GAGGGGGCAGGGTAGGGGGGAGG - Intergenic
1171413988 20:24965267-24965289 GAGGCGGCAGGGCAGGGCCCAGG - Intronic
1171869564 20:30514235-30514257 GGGGCTGCAGGGGAGGGGGGAGG + Intergenic
1172186309 20:33033105-33033127 GAGGGTGGTGGTTAGGGCAGAGG + Intronic
1172872980 20:38147322-38147344 GAAGCTGCAGAGGTGGGCAGGGG - Intronic
1172882056 20:38208493-38208515 GAGGCTGAAGTGGAGGGCAGAGG + Intergenic
1172950062 20:38717459-38717481 GAGTCTGCAGGGCAGGGCTTGGG - Intergenic
1173229805 20:41185344-41185366 CAGGCTGGAGGGTGGGGGAGTGG - Intronic
1173391531 20:42639424-42639446 GAGGCTGCATGCAAAGGCAGTGG - Intronic
1173865761 20:46311768-46311790 GAGCCTGCAGGTTTGAGCAGGGG + Intergenic
1173871625 20:46345636-46345658 AAGGCGGCAGGTTAGGGCAGAGG - Intergenic
1173996211 20:47340448-47340470 CAGGCTGCAGTGTAGTGCAGTGG - Intronic
1174109063 20:48185235-48185257 GAGGCTTCAGGGTAGAGAACAGG + Intergenic
1174505898 20:51017411-51017433 GAGGGTGCCTGGAAGGGCAGAGG + Intronic
1174726625 20:52869334-52869356 GAGGCTGGAGTGGTGGGCAGAGG + Intergenic
1175014552 20:55775326-55775348 GAGGATGGGTGGTAGGGCAGAGG - Intergenic
1175246613 20:57586064-57586086 GAGGCTTCAGGGGAGAGAAGGGG + Intergenic
1175290357 20:57871140-57871162 GAGGCTGCTCCGTAGGGCAGAGG - Intergenic
1175309979 20:58005100-58005122 GAGTCTCCAGGGTAGGGCTCAGG - Intergenic
1175482048 20:59318626-59318648 AAGGCTGTAGGGCAGGGGAGGGG + Intronic
1175675523 20:60943402-60943424 GTGACTGCAGGGTAGGGCAGCGG + Intergenic
1175816984 20:61888314-61888336 GAGGCTGCAGAGATGGGCTGGGG - Intronic
1175874263 20:62221986-62222008 GAGGCTGCAGGAGATGGCATTGG + Intergenic
1175948071 20:62567978-62568000 GAGGCTGCGGGGGGGAGCAGGGG - Intronic
1175978094 20:62723645-62723667 AAGGGTGCAGGGCAGGGCAGTGG - Intronic
1176001431 20:62833201-62833223 GATGGAGCAGGGTCGGGCAGAGG + Intronic
1176092639 20:63325795-63325817 GAGGCTGTGGGGTAGGGAGGGGG + Intronic
1176159897 20:63642577-63642599 GTGGCGGCAGGGTATGGCGGGGG - Intronic
1176178054 20:63737869-63737891 GAGGCTGCAGGGCAGTGCGACGG + Exonic
1176268588 20:64223628-64223650 GAGGCTGGAGGGTGGGGGATGGG - Intronic
1176286445 21:5021601-5021623 GAGGCTGCTAGACAGGGCAGCGG - Intergenic
1176290649 21:5042793-5042815 GAGGTTGCAGCGCAGTGCAGTGG + Intergenic
1176309644 21:5142812-5142834 GAAGCTGCAGCATCGGGCAGTGG - Intronic
1177063103 21:16397355-16397377 GGGGTTGTAGGGTAGGGGAGCGG + Intergenic
1178211781 21:30542954-30542976 GTGGGTGCAGGGTAGGGGTGGGG - Intronic
1178722631 21:35023477-35023499 GAGGCTGCAGCTCATGGCAGGGG + Intronic
1178807345 21:35850777-35850799 AAGGCTGCAGGGGAGTGCACAGG - Intronic
1178900412 21:36593476-36593498 GAGGGTGCAGAGGAGAGCAGAGG + Intergenic
1179139746 21:38714249-38714271 GAGGATGCCGGGGAGGGCAGTGG - Intergenic
1179196876 21:39172210-39172232 GAGCAGGCAGGGTGGGGCAGGGG + Intergenic
1179416036 21:41199422-41199444 GATGCTGCAGGGGGTGGCAGTGG + Intronic
1179440188 21:41388107-41388129 GGTGCTGCCGGGAAGGGCAGAGG - Intronic
1179459317 21:41523178-41523200 GGGGCTCCAGTGTGGGGCAGAGG + Intronic
1179554456 21:42163398-42163420 GAGACTGCATGGCTGGGCAGGGG + Intergenic
1179572574 21:42286667-42286689 GATGCTGCTGAGTGGGGCAGGGG + Intronic
1179717911 21:43299467-43299489 GAGGCTGGAGAGAAGAGCAGAGG - Intergenic
1179797557 21:43794232-43794254 GAGGCTCCAGGGCAGGCCAGGGG + Intronic
1179803954 21:43825745-43825767 GAGGCTGCAGGCTGGGGCTGAGG - Intergenic
1179847414 21:44119221-44119243 GAAGCTGCAGCATCGGGCAGTGG + Intronic
1179866606 21:44220848-44220870 GAGGTTGCAGCGCAGTGCAGTGG - Intergenic
1179870736 21:44241874-44241896 GAGGCTGCTAGACAGGGCAGCGG + Intergenic
1179953932 21:44727492-44727514 GAGGCTGCGGCGGAGGGGAGGGG - Intergenic
1179982613 21:44904179-44904201 AAGGCTGGAGGGTGGGGCAGAGG - Intronic
1180086327 21:45509497-45509519 GGGGCTCCGGGGTAGGGCTGGGG - Exonic
1180090777 21:45532978-45533000 GAGGAAGTGGGGTAGGGCAGAGG + Intronic
1180708029 22:17821588-17821610 GAGGGTGGAGGGGAGGGTAGAGG + Intronic
1180739702 22:18044599-18044621 GAGGGTGCACGGGAGGTCAGTGG + Intergenic
1180836470 22:18932132-18932154 GTGCCTGCAGGGTAGGGCAGGGG + Intronic
1181308628 22:21931322-21931344 GAGGAGGTAGGGAAGGGCAGAGG + Intronic
1181310746 22:21943583-21943605 GGGGGCGCAGGGGAGGGCAGTGG - Intronic
1181510773 22:23387905-23387927 CGGGCTGCAGCGCAGGGCAGGGG - Intergenic
1181541207 22:23574173-23574195 GAGGCTGCTGGGGTGGGCATGGG - Intronic
1181783123 22:25207272-25207294 GAGGCTCCAGGGTTGGGGCGAGG + Exonic
1181797176 22:25319157-25319179 GAGGCTGCTGGGGTGGGCATGGG + Intergenic
1182035783 22:27197246-27197268 GAGGCTGCAGACCTGGGCAGGGG - Intergenic
1182438253 22:30345234-30345256 CAGGCTCCAGGGGAGGGGAGGGG + Intronic
1182452536 22:30429820-30429842 GGGGCTGCAGGGCTGGGTAGGGG + Intergenic
1182832664 22:33316245-33316267 GGAGCTGCAGGGTAGGAGAGAGG + Exonic
1183096095 22:35553192-35553214 GGGGCAGCAGGGGCGGGCAGAGG - Exonic
1183305917 22:37083153-37083175 GAGGTTGGAAGGGAGGGCAGAGG + Intronic
1183458569 22:37936109-37936131 GAGCCTGCAGGCTGGGGGAGGGG + Intronic
1183478574 22:38050543-38050565 GGGGGTGGAGGGGAGGGCAGAGG + Intergenic
1183539689 22:38422924-38422946 GAGAGGGCAGGGCAGGGCAGAGG + Intergenic
1183759957 22:39807002-39807024 GAGGCTGCAGGGGTGAGCACAGG + Intronic
1183826039 22:40388481-40388503 GAGGCTGCAGGGAGTAGCAGGGG + Intronic
1183933668 22:41249841-41249863 CAGGCTGCTGGCTATGGCAGAGG + Intronic
1183999493 22:41662546-41662568 GAGGCTGCAGAGTAGTTCATTGG + Intronic
1184128139 22:42501785-42501807 GGGGCTGAAGGGAAGGCCAGGGG + Intergenic
1184136929 22:42555098-42555120 GGGGCTGAAGGGAAGGCCAGGGG + Intronic
1184391855 22:44207430-44207452 GAGGCTGGTGGGGAGGGCTGGGG + Exonic
1184421567 22:44385436-44385458 GTGGGTGCTGGGTAGGGCATGGG - Intergenic
1184453640 22:44597208-44597230 GAGGCTGCAGGGTCGGGTGAGGG + Intergenic
1184533355 22:45070762-45070784 CAGGGTGAGGGGTAGGGCAGGGG - Intergenic
1184564538 22:45284440-45284462 GAGGCTGGGGGGTGGGGCAGGGG - Intergenic
1184645276 22:45891825-45891847 TAGGCTGCTGGGTGGGGAAGGGG - Intergenic
1184691451 22:46119179-46119201 GAGGCAGCAGGGGAGGGCAGGGG + Intergenic
1185047685 22:48537207-48537229 GTGGGGGCAGGGTGGGGCAGGGG + Intronic
1185071984 22:48661622-48661644 GAGGGGGCAGCGTATGGCAGTGG + Intronic
1185214043 22:49588280-49588302 GAGGGTCCAGGGTGGGGCTGGGG - Intronic
1185214462 22:49590516-49590538 GAGGCTGCAGGGCGAGGCTGGGG + Intronic
1203286562 22_KI270734v1_random:157431-157453 GTGCCTGCAGGGTAGGGCAGGGG + Intergenic
949581584 3:5393815-5393837 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
950112128 3:10425988-10426010 GAGACTGCAGAGGAGAGCAGGGG - Intronic
950978952 3:17280884-17280906 GGGGCTTCAGGGTGGGGGAGTGG + Intronic
952289659 3:32003094-32003116 GAGGCACCAGAGTGGGGCAGAGG + Intronic
952845684 3:37686246-37686268 GAGGGAGCAGGGAGGGGCAGGGG + Intronic
953062573 3:39439409-39439431 CAGGCTGCAGGGTAGAGCAAAGG + Intergenic
953672656 3:44975991-44976013 GGGACTGCAGGGGAAGGCAGCGG - Exonic
953885965 3:46714542-46714564 CAGGCTGGAGGCTGGGGCAGGGG - Intronic
954274477 3:49533215-49533237 GTGGAGGCAGGGTAGGGCAGGGG + Exonic
954618156 3:51980817-51980839 GAGTCTGCAGGGCAAGGCAGGGG - Exonic
954808356 3:53233021-53233043 CAGGCTCCAGGGAAGGGGAGCGG - Intronic
955059078 3:55481464-55481486 GACGCGGGAGGGAAGGGCAGGGG + Intronic
955103392 3:55873608-55873630 GAGGCTGGAGAGGTGGGCAGAGG - Intronic
956719036 3:72102132-72102154 GATGCTGCAGTTTAGGGGAGTGG + Intergenic
958466818 3:94469979-94470001 CAGGCTTCAGGGTGGGGCGGTGG + Intergenic
958488350 3:94741124-94741146 AAATCTGCAGGGTAGGGCCGTGG + Intergenic
959559869 3:107767332-107767354 GAGGCATCAGGGTAAGGCAGAGG + Intronic
959559938 3:107767932-107767954 GAGGCATCAGGGTAAGGCAAAGG + Intronic
959849820 3:111072381-111072403 GCGGCCGCGGGGGAGGGCAGCGG - Intronic
960388072 3:117045115-117045137 GAGGGAGCAGGATTGGGCAGAGG + Intronic
961032295 3:123617096-123617118 GAGGGTGCAGGGCATGGGAGTGG - Intronic
961186252 3:124917765-124917787 GAGGCGGCAGGGAGTGGCAGTGG + Intronic
961418808 3:126783092-126783114 GAGGCTATGGGGTAGGGGAGAGG - Intronic
961588339 3:127954715-127954737 GAGGCTGCAGGGGCAGGCTGGGG - Intronic
961797269 3:129418455-129418477 GAGGTGAGAGGGTAGGGCAGAGG + Intronic
961801332 3:129452404-129452426 GAGAGTGCTGGGCAGGGCAGGGG + Intronic
962372036 3:134828716-134828738 GAGGCTGCAGGCCAGGGAAGGGG + Intronic
962431326 3:135323198-135323220 GATGCCCCAGGGTGGGGCAGCGG - Intergenic
962479894 3:135788904-135788926 TAGGCTGAAGAGGAGGGCAGAGG - Intergenic
962661792 3:137609132-137609154 AAGGCTGGAGGGTAGAGCAGTGG - Intergenic
962677925 3:137770122-137770144 GACGCTGCAGGGATGGGCATCGG + Intergenic
962741046 3:138362710-138362732 AAGGCTGCAGGGCTAGGCAGGGG - Intronic
962906097 3:139804404-139804426 GAGCATGCAAGGTGGGGCAGGGG + Intergenic
963003820 3:140707431-140707453 GATTCTGCAGGGTAGGGCACTGG + Intergenic
964627916 3:158776766-158776788 AAGGCTGCAGGGCAGGCCTGGGG + Intronic
964993140 3:162840550-162840572 GAGGGTGGAGGGTAGGAAAGGGG - Intergenic
965691106 3:171357892-171357914 GAGGCTGGAGGGGGAGGCAGAGG + Intronic
967869044 3:194214504-194214526 GAGGCTGCAGGGTTCTCCAGAGG + Intergenic
968383657 4:116979-117001 GAGGCTGCAGGCCCGGCCAGAGG + Intergenic
968458481 4:711254-711276 GGAGCTGCAGGGTGCGGCAGGGG + Intronic
968490955 4:890254-890276 GAGGCTCCAGGGCAGGGCCCAGG - Intronic
968520132 4:1031384-1031406 GTGGCCGCAGGGTGGGGCTGGGG + Intergenic
968555077 4:1242730-1242752 GAGGCTGCAGCGCAGGTCATGGG - Intronic
968584561 4:1410135-1410157 GGGGCTCTAGGGTTGGGCAGAGG + Intergenic
968804504 4:2763639-2763661 GGAGCTGCGGGGAAGGGCAGCGG - Intergenic
968842392 4:3017031-3017053 GAGGGTGCAGGCAGGGGCAGAGG - Intronic
968923085 4:3532615-3532637 GAGGCTGCAGACTCTGGCAGGGG + Intergenic
968931483 4:3581781-3581803 GAGGCAGCTGGGTGGGGCAGGGG - Intronic
969341269 4:6543253-6543275 AAGGCAGCAGGATTGGGCAGAGG - Intronic
969529194 4:7720845-7720867 GAGGATGCAGGGAAGGACACTGG + Intronic
969580286 4:8060810-8060832 GAGCCGGCAGGGCAGGGCGGTGG - Intronic
969620236 4:8275271-8275293 GGGGCTGCATGGGAGGGCAGAGG - Intronic
969683502 4:8656319-8656341 GAGCCTGCAGGTCAGGGCGGTGG + Intergenic
970604364 4:17665651-17665673 GAGGCTGGAGGGTAGGGCCTTGG + Intronic
971522717 4:27574783-27574805 GAGGGTGGAGGGTAGGTCAAGGG - Intergenic
972051012 4:34733369-34733391 GAGTCTGCAGAGTTAGGCAGTGG - Intergenic
972576698 4:40358380-40358402 GAGGCTGGAGGGGAGTGCAGTGG - Intergenic
972641846 4:40932642-40932664 GAGGGTGAAGGGGAGGGGAGGGG + Intronic
972802330 4:42490118-42490140 CAGGCTGCAGGTCAGGGAAGGGG - Intronic
973675997 4:53263646-53263668 GAGGCAGCAGGGGAGTGAAGTGG + Intronic
974186558 4:58454685-58454707 GTGGGTGCAGGATAGGGGAGTGG + Intergenic
975243751 4:72094229-72094251 GAGGCGGCAGGGGAGTGAAGTGG + Intronic
975354956 4:73391415-73391437 GAGGGTGGAGGGGAGGCCAGAGG - Intergenic
975632588 4:76417899-76417921 GAGGCTGCAGGGTAGCTAAGTGG + Intronic
976316876 4:83667818-83667840 GGGACTCCAGGGTTGGGCAGAGG + Intergenic
976380016 4:84388556-84388578 CAGGCTACAGGGTGGGGGAGGGG + Intergenic
976711976 4:88082148-88082170 CAGGCTGGAGTGTAGTGCAGTGG - Intergenic
976774473 4:88692348-88692370 GGGGCTGGGGGGTGGGGCAGTGG + Intronic
976919192 4:90416007-90416029 GTGGCTTCAGGGTAGGGAAATGG + Intronic
976999598 4:91481094-91481116 GAGGCTGTAGGGGAGGGGAAGGG - Intronic
977110237 4:92943877-92943899 GAGGCTGCAGAGCAGAACAGCGG + Intronic
977667080 4:99654089-99654111 GAGGCTGAAGGCTTGGGAAGTGG + Exonic
978000508 4:103552109-103552131 CAGGCTGGAGTGGAGGGCAGTGG - Intergenic
978494906 4:109348247-109348269 GCGGCAGATGGGTAGGGCAGTGG - Intergenic
979201562 4:117985377-117985399 GGGGCTGCGGGGTGGGGGAGGGG - Intergenic
979584784 4:122403388-122403410 GAGGTGGCAGGGTAGCGAAGTGG + Intronic
979741684 4:124159174-124159196 GAGGCTGGAGAGCAGGGCAGAGG - Intergenic
980030037 4:127817023-127817045 GAGGTTGTAAGGTAGGGCAGGGG + Intronic
980560707 4:134470690-134470712 GTGGCTGGAGGGTAAGGAAGAGG - Intergenic
981060638 4:140420955-140420977 GGGGCTGGAGGGAAGGGTAGTGG - Intronic
982173505 4:152683717-152683739 GAGGTAGCCGGGCAGGGCAGAGG + Intergenic
982827621 4:160020487-160020509 GAGTCTGGATGGTAGGGTAGTGG - Intergenic
983203419 4:164886863-164886885 TAGGCTGGAGTGTAGTGCAGTGG + Intronic
984996356 4:185434177-185434199 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
985022167 4:185703162-185703184 GAAGCTCAAGGGTAGGGCACTGG - Intronic
985369253 4:189267772-189267794 GTGGCTGCAGGGTAAAGTAGAGG + Intergenic
985553206 5:543567-543589 GAGGCTACAGCGGAGGCCAGAGG + Intergenic
985638190 5:1050525-1050547 GAGGCTGCAGCCCAGGGCGGGGG + Exonic
985675657 5:1230113-1230135 CAGGCTGGAGGGGAGGGAAGAGG + Intronic
985704405 5:1392177-1392199 GAGGCTCTTGGGTTGGGCAGTGG + Intergenic
985838511 5:2288592-2288614 GAGGCTGCCGGGGAGGGCTCCGG - Intergenic
986461983 5:7982214-7982236 GAGGAGGCAGGGTTGGACAGAGG + Intergenic
986471533 5:8081309-8081331 GAGTGTGCAGGGGAGGGCATGGG + Intergenic
987011492 5:13770613-13770635 GTGGCGGCAGGGCAGGGAAGGGG - Intronic
987037928 5:14036730-14036752 AGGGCTGGAGGGCAGGGCAGGGG - Intergenic
988697304 5:33635409-33635431 GAGGCTGCAGAGTCAGGCATGGG + Intronic
988793134 5:34627372-34627394 GAGGCTGAAGAGGAGGGCAAAGG + Intergenic
989001225 5:36762734-36762756 GGGGGTGCAGCATAGGGCAGGGG + Intergenic
989099637 5:37811920-37811942 GAGGCTCCAGGGTGGTGCTGAGG - Intergenic
989667658 5:43874694-43874716 GAAGATGCAGGGTGGGGCTGAGG + Intergenic
990493394 5:56322918-56322940 GGGGCACCAGGCTAGGGCAGGGG + Intergenic
990918531 5:60937173-60937195 GAGGCAGCAGGGGAGTGAAGTGG + Intronic
991931621 5:71758486-71758508 GGGGCTGGAGGGCAGGGAAGTGG - Intergenic
992502356 5:77355394-77355416 GAGGCTGCAGCGAATGGCAATGG + Intronic
992597624 5:78361400-78361422 GAAGCAGCTGGGTAGGGAAGAGG - Intronic
992747448 5:79833629-79833651 GTGGCTGCAGGCAAGGGCAAGGG - Intergenic
993029088 5:82683379-82683401 GGGGCTGCAGGGAAGGGGAATGG + Intergenic
993307167 5:86287879-86287901 GAGGCTGCCTGGGAGGACAGTGG - Intergenic
993671174 5:90763668-90763690 GAGGCAGCAGGGTAGGAGTGGGG - Intronic
994118322 5:96085770-96085792 GATGCTGCTGGATAGGGCAGGGG + Intergenic
994743761 5:103653509-103653531 GAGTCTCCAGGGTAGGGCTCTGG - Intergenic
995390161 5:111632072-111632094 GAGGATGCAGAGGAAGGCAGGGG - Intergenic
995842089 5:116452173-116452195 GAGGATGCAGGGGTTGGCAGAGG - Intronic
995914812 5:117232192-117232214 AAGGCTGCAGGGTAGAACAGTGG + Intergenic
997045508 5:130312274-130312296 TAGGCTGGAGGGCAGTGCAGTGG + Intergenic
997264347 5:132486439-132486461 CAGGCTGCAGGGTTGGTCGGAGG - Intronic
997469132 5:134107071-134107093 GGGGCTGGAGGCTAGAGCAGGGG - Intergenic
997852724 5:137347039-137347061 GACGCTGCAGGGGAGGTAAGTGG - Intronic
998241405 5:140448519-140448541 GAGGGTGTAGGGTGGGGCAAAGG - Intronic
999209577 5:149876393-149876415 CAGGCTGGAGGGCAGTGCAGTGG + Intronic
999838976 5:155403622-155403644 GAGGCAGCAGGGGAGTGAAGTGG - Intergenic
1000079425 5:157830926-157830948 GAGGGTGGAGGGTGGGGCTGAGG + Intronic
1000330316 5:160200362-160200384 GAGGCTGCAGGGAACAGCAGAGG + Intronic
1000342577 5:160289145-160289167 GAGGCTGCTGGGTAGGAGGGAGG - Intronic
1000613751 5:163405352-163405374 CAGGCTGGAGTGTAGTGCAGTGG + Intergenic
1001581928 5:172804834-172804856 GATGCTGCAGGGCAGGCCTGTGG + Intergenic
1001803077 5:174560105-174560127 GTGGAAGCAGGATAGGGCAGGGG - Intergenic
1001969609 5:175943997-175944019 GGGGGTGCAGGGTGGGCCAGGGG + Intronic
1002247825 5:177899756-177899778 GGGGGTGCAGGGTGGGCCAGGGG - Intergenic
1002301466 5:178259655-178259677 GTGGCTGGAGAGAAGGGCAGGGG - Intronic
1002491031 5:179577579-179577601 GGGGCTGGAGGGGAGGGCGGGGG + Intronic
1002491050 5:179577631-179577653 GGGGCTGGAGGGGAGGGCGGGGG + Intronic
1002817353 6:693180-693202 GAGCCTTCAGGGGAGGGTAGAGG + Intergenic
1002895786 6:1379413-1379435 GAGCCTACAGGGTAGAGTAGGGG + Intergenic
1003065788 6:2902922-2902944 GAGGCTGCAGGGGAGGGCTTCGG + Intronic
1003086383 6:3064317-3064339 GAGGCTGCAGGGGAGGGCTTCGG - Intronic
1003854518 6:10259382-10259404 GAGGCTGCAGGGAAGGGCAGAGG + Intergenic
1003994281 6:11523200-11523222 GAGGCTGGAGCTTAGGGGAGAGG + Intergenic
1004617389 6:17303514-17303536 GAGGGGGGAGGGGAGGGCAGGGG + Intergenic
1005114233 6:22318491-22318513 GAGGCTGCAGGGGAGCCCACCGG + Intergenic
1005147231 6:22705439-22705461 GAGGATTCAGAGTAGGCCAGGGG - Intergenic
1005450301 6:25965580-25965602 CAGGCTGTAGTGGAGGGCAGTGG - Intronic
1005724288 6:28633725-28633747 GAGGCGGAAGGGTTGGGCAGGGG - Intergenic
1005821777 6:29604763-29604785 GAGGGTGAACGGAAGGGCAGAGG + Intronic
1005873649 6:29995418-29995440 GAGGCAGCAGAGCAGGGCAGGGG - Intergenic
1005932307 6:30492605-30492627 GTGGGTGGAGGGTGGGGCAGAGG + Intronic
1006638027 6:35474345-35474367 CTGGCCGCAGGGTAGGGGAGAGG - Exonic
1007018679 6:38496607-38496629 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1007386915 6:41526480-41526502 AGGGCTGCAGGGTGGGCCAGGGG + Intergenic
1007756102 6:44100843-44100865 GAGTCTGCAGGGCAGGGTAGGGG - Intergenic
1007816787 6:44530608-44530630 CAAGCTGCAGGGCAGGCCAGTGG + Intergenic
1007828805 6:44622281-44622303 CAGCCAGCAGGGTAAGGCAGAGG + Intergenic
1008446765 6:51600657-51600679 GAGGTTGCAGAGTAGGTAAGTGG + Intergenic
1010760419 6:79716182-79716204 GTGGCTGCAGGGTAAGGGTGGGG + Intergenic
1011508417 6:88073455-88073477 GAGTCTGTGGGGTGGGGCAGGGG + Intergenic
1012405417 6:98891440-98891462 GAGACTGCAGGGCAAGGCAAAGG - Intronic
1014508079 6:122283777-122283799 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
1015181622 6:130366616-130366638 GAGGCTGTAGCGGAGGGGAGGGG - Intronic
1015721790 6:136250178-136250200 GAGGCTCCAGGGCTGGGCACCGG - Exonic
1015863395 6:137703414-137703436 CAGACTGCAGGGAATGGCAGTGG - Intergenic
1015923330 6:138286971-138286993 GACCCAGCAGGGTGGGGCAGGGG + Intronic
1016497053 6:144675353-144675375 GAGGCTGCAGGGGAGTGAAGTGG + Intronic
1017191201 6:151654589-151654611 GTGGCTGCAGCTTGGGGCAGAGG + Intergenic
1017202979 6:151775787-151775809 GAGGCTACAGCCTAGAGCAGTGG + Intronic
1018198724 6:161376765-161376787 AAGGAAGCAGGGTTGGGCAGAGG - Intronic
1018577446 6:165274412-165274434 GAGGCTGCAGGGTAGAGGTGGGG + Intergenic
1018877375 6:167834940-167834962 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1018977007 6:168573730-168573752 GAGCCTGCAGGGTGGGGAGGCGG - Intronic
1018986038 6:168637979-168638001 GGCGCTGCAGGGTGGGGCAGGGG - Intronic
1019005064 6:168789945-168789967 CAGGCTGCAAGCAAGGGCAGTGG - Intergenic
1019039548 6:169092227-169092249 GAGGATGCAGGGAAGGTGAGAGG + Intergenic
1019050193 6:169176798-169176820 GAGGCTGCAGGGTCCAGGAGAGG + Intergenic
1019109595 6:169699262-169699284 GAGGCTGCAGGGAGGGACAAAGG + Intronic
1019285309 7:220303-220325 GACTCTGCTGGGCAGGGCAGGGG - Intronic
1019289741 7:244601-244623 TGGGGTGCAGGGCAGGGCAGTGG - Intronic
1019648384 7:2143007-2143029 GAGCCTTCAGGGCATGGCAGGGG - Intronic
1020093133 7:5352542-5352564 GAGGCTGCTGGGAGGGGCACTGG - Intronic
1020116351 7:5478493-5478515 GGGGCTGCAGGGCCGGGAAGGGG + Intronic
1021622815 7:22564862-22564884 GAGCCTGCAAGGTCAGGCAGTGG - Intronic
1021962799 7:25889347-25889369 GGGGCTGGAGGGTAAGGCATAGG - Intergenic
1022108069 7:27210925-27210947 GAGGCAGGAGGGTATGGCGGGGG - Intergenic
1022508385 7:30920824-30920846 GGGGCTGCAAGGCAGGGGAGGGG + Intronic
1023530644 7:41149824-41149846 GGGGCTGCTGGGTAGGGCTCCGG + Intergenic
1023912906 7:44568072-44568094 GAGGCAGCAGGCTGGGGAAGTGG - Intronic
1023978381 7:45050904-45050926 AAGGGGGTAGGGTAGGGCAGAGG + Intronic
1024456409 7:49613451-49613473 CAGGCTGGAGTGCAGGGCAGTGG + Intergenic
1024533878 7:50413838-50413860 GAGGCTGCAAGGGAGGGAGGGGG + Intergenic
1024960455 7:54969343-54969365 GAGGCTGCAGGGAGAGGCTGGGG + Intergenic
1025086210 7:56025631-56025653 CAGGCTGGAGTGTAGTGCAGTGG + Intronic
1025086325 7:56026442-56026464 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1026151015 7:67788190-67788212 GGGGCTGCAGGACAGGGGAGAGG - Intergenic
1026217847 7:68365258-68365280 GAGGATGGAGGGAAGGGGAGGGG + Intergenic
1027052162 7:75027400-75027422 GAGGCTGCTGGCGAGGGCAGGGG - Intronic
1029506420 7:100966274-100966296 GGGGCTCCAGCCTAGGGCAGCGG - Intronic
1029610046 7:101622047-101622069 GGGGCAGCAGGGAATGGCAGGGG - Intronic
1029745794 7:102515209-102515231 TTGGCTGCAGAGTCGGGCAGGGG - Intronic
1029763732 7:102614188-102614210 TTGGCTGCAGAGTCGGGCAGGGG - Intronic
1030232746 7:107225147-107225169 GTGGCTGCAGGGGAGGGCAATGG - Intronic
1032222330 7:130004014-130004036 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
1032467109 7:132153076-132153098 GAGCCTGCTGGTCAGGGCAGGGG + Intronic
1032498948 7:132385259-132385281 GTAGCTCAAGGGTAGGGCAGAGG + Intronic
1032803774 7:135336770-135336792 GAGGCTGGAGGAGTGGGCAGGGG + Intergenic
1032936713 7:136740861-136740883 GAGGGTGAAGGGTGGGGGAGAGG - Intergenic
1033477732 7:141706884-141706906 GAGGCTGTAGGGAAGGGCCAAGG + Intergenic
1034264023 7:149772863-149772885 GGGGCTGGAGGGAAGGGCGGGGG - Intronic
1034424536 7:151007575-151007597 GGGGGTGCAGGGCAGGGCAGGGG + Intronic
1034547891 7:151800928-151800950 GGGGCTGCAGGGTCAGGGAGGGG + Intronic
1035000577 7:155609471-155609493 GAGGGTGCAGGGCAGGGCTCTGG - Intergenic
1035045760 7:155964287-155964309 GAGGCTGGCGGGGAGGGCTGTGG + Intronic
1035057662 7:156046726-156046748 AAGGCTGAAGTGTGGGGCAGAGG + Intergenic
1035084937 7:156250265-156250287 GAGGCTACTGAGTAGGGGAGTGG - Intergenic
1035133885 7:156681207-156681229 GAGGCTGCAGGGAGGGCCATGGG + Exonic
1035320976 7:158029099-158029121 GAGGCTGCCAGGCAGGACAGAGG - Intronic
1035389606 7:158496406-158496428 GAGGCTGCAGGGAAGGGGAGGGG - Intronic
1035389728 7:158496701-158496723 GAGGCTGCAGGGAAGGGGGAGGG - Intronic
1035389770 7:158496796-158496818 GAGGCTGCAGGGAAGGGGGAGGG - Intronic
1035389825 7:158496932-158496954 GAGGCTGCAGAGAAGGGGAGGGG - Intronic
1035389872 7:158497049-158497071 GGGGGTGCAGGGAAGGGGAGGGG - Intronic
1035520039 8:268234-268256 GAGGCTGAAGGAGTGGGCAGAGG + Intergenic
1036392295 8:8334014-8334036 GAGGATGAAGGGTGGGGCAGAGG + Intronic
1036605067 8:10297269-10297291 GGGGCTGTGGGGTAAGGCAGTGG + Intronic
1036673194 8:10806757-10806779 TAGGATGCAGCGGAGGGCAGGGG + Intronic
1036749579 8:11435299-11435321 GAGGCCGCATGGAGGGGCAGTGG - Intronic
1037606730 8:20444185-20444207 GAGGCTCCAGGGTCTTGCAGGGG + Intergenic
1037608741 8:20458892-20458914 GAGGCTGCGGAGTGGGGGAGTGG - Intergenic
1037645028 8:20785247-20785269 GAGGCTGGAGGGGCAGGCAGGGG + Intergenic
1037810220 8:22082337-22082359 GGGGGTGTAAGGTAGGGCAGGGG - Exonic
1037971756 8:23176872-23176894 GAGGATGCAGGGAAGTTCAGGGG + Intergenic
1038006655 8:23436326-23436348 TAGGCTGCAGGGAAGGGGACTGG + Intronic
1038255515 8:25947612-25947634 GAGGCTGCAGAGGCTGGCAGGGG - Intronic
1038268238 8:26052220-26052242 GAGGCTGCGGGGTGCGGCAGTGG + Intergenic
1038308051 8:26422207-26422229 GAGGATACAGGAGAGGGCAGAGG + Intronic
1038627375 8:29207157-29207179 GAGGCTGGAGAGTTGGGGAGTGG - Intronic
1038663797 8:29520106-29520128 GAGGCAGAAGCGTAGGTCAGAGG + Intergenic
1039162562 8:34639207-34639229 GATGGTGCAGGGCAGGGCCGTGG - Intergenic
1039763881 8:40607927-40607949 GAGGCAGCAGGGGAGTGAAGTGG + Intronic
1041636670 8:60153121-60153143 GGGGGTGCGGGGGAGGGCAGGGG + Intergenic
1041843457 8:62298544-62298566 GTGGCTGCAGTGCAGTGCAGTGG - Intronic
1043718340 8:83511363-83511385 GAGGTGGCAGGGGAGGGAAGTGG + Intergenic
1043876373 8:85491354-85491376 GAGGTAGCAGGGGAGTGCAGAGG + Intergenic
1045060818 8:98409406-98409428 AAGGATGCAGGGAATGGCAGAGG - Intronic
1045216679 8:100156197-100156219 GAGGTTGCAGAGGTGGGCAGAGG + Intergenic
1045325797 8:101116770-101116792 GGGACTGCTGGGTAGGTCAGTGG + Intergenic
1045354341 8:101372026-101372048 GAGGAAGCAGGATTGGGCAGAGG + Intergenic
1045402726 8:101834889-101834911 GTGGCTTCAGGGTAGGGCACAGG + Intronic
1045557130 8:103225523-103225545 GAGGAAGCAGGGCAGGGCAGGGG + Intronic
1045814228 8:106261167-106261189 GAGGTAGCAGGGGAGAGCAGTGG + Intergenic
1046664127 8:116980359-116980381 GAGGTAGCAGGAAAGGGCAGGGG + Intronic
1047738629 8:127788961-127788983 GAGGCTGCCAGGTAGGGCTGGGG + Intergenic
1048574456 8:135679915-135679937 GAGGGAGCAGGGTAGAGCAGAGG - Intergenic
1048876894 8:138843563-138843585 GAGGGTGCGGGGTATGGCCGAGG - Intronic
1049113013 8:140661264-140661286 GAGGCTGAATGGAAGGGCAGGGG + Intronic
1049209466 8:141378873-141378895 CAGGCTTCAGGGTGGGGCGGGGG - Intergenic
1049372625 8:142274979-142275001 GAGGCTGCAGGGATGGGCGCTGG + Intronic
1049377161 8:142294751-142294773 GCTGCTGCAGGGACGGGCAGTGG + Intronic
1049391185 8:142372522-142372544 GAGGCTGCGGGGTGGAGCGGGGG + Intronic
1049428789 8:142549736-142549758 CAGGCTGCAGAGCAGGGCTGTGG - Intergenic
1049499378 8:142953431-142953453 GAGGCAGCAGGGGTGGGGAGGGG - Intergenic
1049710399 8:144060602-144060624 GAGGCAGCGGGGAAGGGCCGCGG + Intronic
1049728406 8:144162433-144162455 CAGGCTGGAGTGTAGTGCAGTGG + Intronic
1051058983 9:13024269-13024291 GTGGCTCCAGGGCAGAGCAGTGG - Intergenic
1051377575 9:16419244-16419266 TAGGCTGCCAGGGAGGGCAGGGG + Exonic
1051642710 9:19238519-19238541 GAGGGGGGAGGGGAGGGCAGGGG - Intronic
1052041606 9:23745373-23745395 GATGGTGGTGGGTAGGGCAGGGG - Intronic
1052097832 9:24406198-24406220 GAGGCTGCAGGATAGGATTGAGG - Intergenic
1052860285 9:33433866-33433888 GAAGCTACTGGGTAAGGCAGTGG - Intergenic
1053024286 9:34717522-34717544 GAGGCTGCTGAAGAGGGCAGTGG + Intergenic
1053062355 9:35042322-35042344 GTGTCTGCAGGCTAGGGCATGGG - Exonic
1053300761 9:36947867-36947889 GAGGGTGCCAGGTAGGGAAGTGG - Intronic
1053416243 9:37948592-37948614 GAGGCTGCCGAGGAGGGCTGGGG + Intronic
1053867088 9:42450850-42450872 CAGGCTGCAGGTGAGGGCAAAGG + Intergenic
1054458646 9:65450148-65450170 GAGGCAGCTGGGTGGGGCAGGGG + Intergenic
1054822936 9:69542170-69542192 GTGTATGCAGGGTAGGGAAGAGG - Intronic
1055400299 9:75916651-75916673 GAGGCTGGAAGGAAGGCCAGTGG + Intronic
1055481581 9:76713510-76713532 GAGCCAGCAGGTTAGGACAGAGG + Intronic
1055552718 9:77446066-77446088 GACTCTGCAGGGAAAGGCAGAGG + Intronic
1056714788 9:89020318-89020340 GAGGCAGCAGGGCAGGGAGGTGG + Intronic
1056733178 9:89183144-89183166 GAGGCTGCAGGAGGGAGCAGAGG + Intergenic
1056793039 9:89638490-89638512 GATGCTGCAAGGAGGGGCAGGGG - Intergenic
1056810855 9:89762806-89762828 GAGGGTGAAGGGCAGGGGAGTGG + Intergenic
1056948117 9:91018056-91018078 GAGGCAGCAGGGGAGTGAAGTGG - Intergenic
1057056115 9:91962267-91962289 GAAGCTGCAGGAGATGGCAGGGG - Intergenic
1057772420 9:97980672-97980694 GAGGCAGCGGGGTGGGGCACAGG + Intergenic
1057836700 9:98451178-98451200 GGGGCTGCAGGGGTGGGGAGAGG + Intronic
1057930704 9:99190578-99190600 GAGGCTGCAGGTTATGGAAAGGG - Intergenic
1058037906 9:100273247-100273269 GAGGCTGCAGTGAAGGACAGAGG + Intronic
1058420463 9:104828416-104828438 GAAGATGCAGGATTGGGCAGAGG - Intronic
1058870200 9:109194791-109194813 GAGGCTGCAGGGAGGGGCTTGGG - Intronic
1059015692 9:110513079-110513101 GAGGCTTCAGGGCAGGGCAGTGG + Exonic
1059197326 9:112382218-112382240 CAGGGTGGAGGGCAGGGCAGTGG - Intronic
1059499307 9:114737502-114737524 GAGGCAGAAGGGGAGGGGAGGGG - Intergenic
1059515251 9:114888793-114888815 GCTGCTGCAGGGTGGGGGAGGGG - Intergenic
1059673831 9:116517256-116517278 GAGGTAGCAGGGTAGTGAAGTGG - Intronic
1060432101 9:123559225-123559247 GAGGCTGGAGAGAAAGGCAGGGG + Intronic
1060508979 9:124218537-124218559 TAGGCTGCAGTGCAGTGCAGTGG - Intergenic
1060595197 9:124843608-124843630 GAGGGTGCAGGGCAGGGTAGGGG - Intergenic
1060607047 9:124924590-124924612 CAGGCTGGAGTGTAGTGCAGTGG - Intronic
1060633118 9:125177590-125177612 GAGGCTGTGGGGAGGGGCAGGGG - Intronic
1060636072 9:125200590-125200612 GGGGCTGGAGGGTAGGGGCGAGG + Exonic
1060816578 9:126638372-126638394 TGGGCTGCAGGGTGGTGCAGAGG - Intronic
1060840349 9:126788597-126788619 GAGGCTGGAGGGGTAGGCAGGGG - Intergenic
1060936230 9:127517758-127517780 GACCCAGCAGGGGAGGGCAGGGG - Intronic
1061079959 9:128364012-128364034 GAAGCTGCAGGGTTGGGGAGAGG + Intergenic
1061213690 9:129208094-129208116 CAGGCTGGAGGGGAGTGCAGTGG + Intergenic
1061239040 9:129358617-129358639 GTGGCTGCAGGGTGTGGGAGGGG - Intergenic
1061262376 9:129487422-129487444 GAGGCTTCAGGGATGGGGAGAGG + Intergenic
1061328762 9:129879520-129879542 GAGGGTGGAGGGCATGGCAGGGG + Intronic
1061408523 9:130405772-130405794 AATGCTGCAGGGCTGGGCAGGGG + Intronic
1061432112 9:130537565-130537587 GAGGCTGCAGCATAGGCCAGCGG - Intergenic
1061488548 9:130933017-130933039 GAGGGTGCAAGATAGGGCAGGGG - Intronic
1061491333 9:130946268-130946290 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1061507408 9:131039239-131039261 GAGGCTGCAGGTGAGGGCGAGGG + Exonic
1061517095 9:131096403-131096425 GAGGCGGGAGGGGAGGGGAGAGG + Intergenic
1061675798 9:132214914-132214936 CAGGCTGAAGGGCAGTGCAGTGG + Intronic
1061765392 9:132878331-132878353 GAGCCTGCAGGGCGGGGCCGCGG - Exonic
1061817419 9:133205441-133205463 GAGGCTGCAGGGTAGGGCAGAGG + Exonic
1061821212 9:133228102-133228124 GGGGCTGCAGGCCAGGGAAGGGG - Intergenic
1061834232 9:133318262-133318284 GGGGCTGCAGGCCAGGGAAGGGG + Intergenic
1061948392 9:133921531-133921553 GAGGCTGCAGGGAGAGGCACTGG - Intronic
1061976568 9:134070982-134071004 GAGGCTGGAGGGCAGGACAGAGG - Intergenic
1062153533 9:135033669-135033691 AAGGCTGCCGGGGAGAGCAGGGG - Intergenic
1062238040 9:135521974-135521996 GGGGCTGCAGGCCAGGGAAGGGG + Intronic
1062242984 9:135549785-135549807 GAGGCTGCAGGGTAGGGCAGAGG - Exonic
1062298364 9:135847861-135847883 GAGGGGGCAGGGAAGGGGAGGGG + Intronic
1062443030 9:136579543-136579565 GAGGCTGCAGGTGAGCGCAGGGG - Intergenic
1062483815 9:136764489-136764511 GGGGCTGGAGGGCAGGGGAGGGG - Exonic
1062698558 9:137887721-137887743 GTGGATGGAGGGTGGGGCAGGGG - Intronic
1203740372 Un_GL000216v2:172228-172250 GAGGCTGCAGGGGAATGCACGGG - Intergenic
1185491886 X:524179-524201 GAGGGTGCAGCCTGGGGCAGGGG + Intergenic
1186757711 X:12690354-12690376 GAGGCTGCAGGTTAGAGCAGAGG + Intronic
1187428794 X:19203192-19203214 GAGGCAGCCAGGTAGGGCTGGGG - Intergenic
1187451404 X:19399692-19399714 GAGGCTGGAGTGGAGTGCAGTGG - Intronic
1188000967 X:24981231-24981253 GAGGCTGCAGGGCAGGTGATGGG + Intronic
1188003468 X:25002499-25002521 GAGGGTGCAGGGTTGGGCAGAGG - Intergenic
1189279793 X:39813068-39813090 AGGGCTGCAGGATGGGGCAGAGG + Intergenic
1189567253 X:42255391-42255413 GAGGCAGCAGGGAAGTGAAGTGG - Intergenic
1189849743 X:45166405-45166427 GAGGCATGAGGGAAGGGCAGCGG + Intronic
1190236077 X:48616770-48616792 GAGGAAGCAGGATCGGGCAGGGG + Intergenic
1190414271 X:50166102-50166124 CAGGCAGAAAGGTAGGGCAGCGG - Intergenic
1190514537 X:51209134-51209156 AAGGCTGCAGGGTAGAACTGAGG + Intergenic
1190520472 X:51274199-51274221 AAATCTGCAGGGCAGGGCAGCGG - Intergenic
1190740416 X:53284787-53284809 GAGGCTGCAAGGTGGGCCAGTGG + Intronic
1190897255 X:54633144-54633166 GAGGAAGCAGGGTAGTGAAGTGG + Intergenic
1192207867 X:69108129-69108151 GAGATGGCAGGGGAGGGCAGTGG - Intergenic
1192240582 X:69324627-69324649 GAGGCTGGAGTGGAGGGCACAGG + Intergenic
1192809637 X:74536963-74536985 GAGGTTGCAGAGGAGGGCGGAGG - Intergenic
1193794126 X:85852423-85852445 GAGGTTAGAGGTTAGGGCAGGGG + Intergenic
1195254793 X:103080989-103081011 GAGGCAGAAGGGGAAGGCAGGGG + Intronic
1195343409 X:103926264-103926286 GTGGCTCCAGGGGAGGGGAGTGG + Intronic
1195365118 X:104117309-104117331 GTGGCTCCAGGGAAGGGGAGTGG - Intronic
1195472009 X:105241005-105241027 CAGGCTGGAGCGTAGTGCAGTGG - Intronic
1196020416 X:110985213-110985235 GAGGTTGCAGAGGAAGGCAGGGG - Intronic
1198119145 X:133574823-133574845 GAGGCTTAAGGGTTGGCCAGCGG + Intronic
1198422630 X:136482717-136482739 GAGACTGCAGGGCAGAGCATGGG + Intergenic
1198778075 X:140202193-140202215 GAGGCTGGGGGGGAGGTCAGTGG + Intergenic
1199526812 X:148801961-148801983 GAGGCTGCAGAATAGGCCATTGG - Intronic
1200052615 X:153443010-153443032 GTGGCAGCAGGGGAGGGGAGGGG - Intergenic
1200071002 X:153529308-153529330 GAGGCTGCAGGGTGGGGGTAGGG + Intronic
1200127639 X:153824140-153824162 GTGGTTGCAGGGATGGGCAGAGG - Intronic