ID: 1062244535

View in Genome Browser
Species Human (GRCh38)
Location 9:135558195-135558217
Sequence ATCTCCCCAGAGAAGATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062244535_1062244539 11 Left 1062244535 9:135558195-135558217 CCATAGATCTTCTCTGGGGAGAT No data
Right 1062244539 9:135558229-135558251 GTTTTTGCCCATTTTCTAGGTGG No data
1062244535_1062244538 8 Left 1062244535 9:135558195-135558217 CCATAGATCTTCTCTGGGGAGAT No data
Right 1062244538 9:135558226-135558248 ATGGTTTTTGCCCATTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062244535 Original CRISPR ATCTCCCCAGAGAAGATCTA TGG (reversed) Intergenic
No off target data available for this crispr