ID: 1062245143

View in Genome Browser
Species Human (GRCh38)
Location 9:135562304-135562326
Sequence CGCCATGGCCATGGAGTGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062245143_1062245146 -1 Left 1062245143 9:135562304-135562326 CCTGGCACTCCATGGCCATGGCG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1062245146 9:135562326-135562348 GACCAACAACATCTCCCTCATGG 0: 1
1: 0
2: 0
3: 11
4: 148
1062245143_1062245152 23 Left 1062245143 9:135562304-135562326 CCTGGCACTCCATGGCCATGGCG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1062245152 9:135562350-135562372 GACACTGAAGGCCCCTCTGAGGG 0: 1
1: 0
2: 0
3: 23
4: 206
1062245143_1062245148 11 Left 1062245143 9:135562304-135562326 CCTGGCACTCCATGGCCATGGCG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1062245148 9:135562338-135562360 CTCCCTCATGGCGACACTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 99
1062245143_1062245151 22 Left 1062245143 9:135562304-135562326 CCTGGCACTCCATGGCCATGGCG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1062245151 9:135562349-135562371 CGACACTGAAGGCCCCTCTGAGG 0: 1
1: 0
2: 1
3: 7
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062245143 Original CRISPR CGCCATGGCCATGGAGTGCC AGG (reversed) Exonic
900025030 1:264690-264712 CACCATGGCTTTGGAGCGCCTGG - Intergenic
900694349 1:4000655-4000677 CTCCAGGACCATTGAGTGCCGGG + Intergenic
902372934 1:16016904-16016926 CCCCATGGCCATGGGTTGCAGGG + Intronic
904939348 1:34154298-34154320 CACCATGGAAATGGTGTGCCAGG - Intronic
906210885 1:44011564-44011586 GGCCATGGCTAGGGAGTGCTGGG + Exonic
907445706 1:54506492-54506514 CACCATGGACATGAAGAGCCTGG + Intergenic
907905626 1:58782320-58782342 CCCCATCGACATGGAGTCCCAGG - Exonic
908256010 1:62304302-62304324 GGACATGGGAATGGAGTGCCAGG + Intronic
910641208 1:89464421-89464443 GGCCATGACCAAGGAGTGCAGGG + Intergenic
912856247 1:113170973-113170995 CGCCAGGGCCATGGAGATGCAGG - Intergenic
913243101 1:116847560-116847582 CTCCATGGCCATGGGTAGCCTGG + Intergenic
915902314 1:159855752-159855774 CGCCATCGCCACGGAGTGCTGGG - Intronic
917517765 1:175722153-175722175 CTCCATGGCCAGGGAGGGCCCGG - Intronic
919778191 1:201207450-201207472 CACCATGGGCCTGGAGTGCTGGG + Exonic
920294317 1:204946612-204946634 GGCCTCGGCCATAGAGTGCCAGG - Intronic
920504667 1:206507599-206507621 GGGCATGGCCATGGCGTCCCCGG + Exonic
1066961774 10:42232505-42232527 GGCCAGGGCCAGGGAGGGCCAGG + Intergenic
1069751830 10:70749895-70749917 CGCCATGGGCCTGGAGTGGGAGG + Exonic
1073336669 10:102714865-102714887 CCCCATTGCCTAGGAGTGCCAGG + Intronic
1073449053 10:103598793-103598815 CGACATGGCCAGGGGGTACCAGG - Exonic
1074759752 10:116658298-116658320 CCCCTAGACCATGGAGTGCCTGG + Intergenic
1076304532 10:129455236-129455258 CGCCCTTCCCCTGGAGTGCCAGG - Intergenic
1076736872 10:132462916-132462938 CACCATGGCGCTGGAATGCCAGG + Intergenic
1077354418 11:2108639-2108661 CGCCAGGGGCAAGGTGTGCCTGG + Intergenic
1080311993 11:30905451-30905473 TGCCATGGCCAGAGAGAGCCTGG + Intronic
1080588115 11:33699674-33699696 CGCCAAGGCCACAGAGTCCCAGG + Intronic
1081528665 11:43943452-43943474 CGCCCTGGCCCGGGAGCGCCGGG + Intronic
1082811882 11:57483218-57483240 CGCCAGGTCCTTGGTGTGCCCGG - Intergenic
1083652709 11:64212441-64212463 AGCCATGGCCAAGGAGTGAGAGG - Intronic
1084358054 11:68652438-68652460 CGCCAAGGCCAGGGTGTCCCAGG - Intergenic
1084358775 11:68656352-68656374 CACCACCGCCATGGAGTGCCAGG + Intergenic
1089499433 11:118923776-118923798 CTCCTTGGCCTTGGAGAGCCAGG - Intronic
1090924819 11:131240143-131240165 CCCCATAGCCATGAAGTGACTGG - Intergenic
1095103289 12:38204338-38204360 CGTCATGGTGATGGAGTGGCTGG - Intergenic
1097192874 12:57227898-57227920 CTCCAGGGCTATGGAATGCCTGG + Intergenic
1101641570 12:106588811-106588833 TGCCACGCTCATGGAGTGCCTGG - Intronic
1103436851 12:120933366-120933388 CGCAAAGGCCATGCAGTGCTGGG - Intergenic
1104230926 12:126883261-126883283 CTACATGGCCCTGAAGTGCCAGG - Intergenic
1104568157 12:129903490-129903512 CGGCCTGGCCATGGACTGGCGGG - Exonic
1104602545 12:130163008-130163030 CTCCATGGACATGGAGCGCCCGG + Exonic
1110470583 13:75855317-75855339 CGCCATGATCATCGAGTCCCTGG + Intronic
1113785969 13:113002222-113002244 GGCCATGGCCCTGGGGTCCCTGG + Intronic
1113981544 13:114281292-114281314 CGCCCCGGCCACGGAGAGCCTGG + Intergenic
1119474363 14:74918644-74918666 GGCCATGGCCAAGGAGGGCTCGG - Intronic
1121423609 14:93832844-93832866 CGCCAAGGCCAGGAACTGCCAGG + Intergenic
1121643026 14:95499087-95499109 ATCCATGGCCCTGCAGTGCCTGG + Intergenic
1122359330 14:101150302-101150324 ACCCTTGGCCTTGGAGTGCCTGG + Intergenic
1122579222 14:102761231-102761253 CGCCTTGGCCCTGGAGGTCCCGG - Intergenic
1122890099 14:104728238-104728260 TGCCTTGGCCAGGGAATGCCTGG + Intronic
1132504824 16:302547-302569 TGCCATCTCAATGGAGTGCCCGG + Intronic
1132559515 16:587024-587046 TGCCATGGCCATTGAGTGTGGGG + Intergenic
1132670127 16:1099087-1099109 CTCCCTGGCCATGGTGTCCCAGG + Intergenic
1136540491 16:30925387-30925409 CACCACGGACAAGGAGTGCCTGG + Intronic
1139433489 16:66923679-66923701 CCCCATGGCCATGCAGTGGCCGG + Exonic
1140723111 16:77788679-77788701 CGCCATGGCCAAGGAAGGCGTGG + Exonic
1141144926 16:81522433-81522455 TGGCATAGCCATGGGGTGCCTGG + Intronic
1141260831 16:82452277-82452299 AGCAATGCCCAGGGAGTGCCAGG + Intergenic
1141600972 16:85126218-85126240 TGCCATGCCCAGGGAGTCCCGGG + Intergenic
1142068553 16:88076529-88076551 CCCCCTGGCCATGCAGTGCTGGG + Intronic
1142456125 16:90224687-90224709 CACCATGGCTTTGGAGCGCCTGG + Intergenic
1142618897 17:1153251-1153273 CGCCAGGCCCATGTAGTGTCAGG - Intronic
1143785633 17:9253575-9253597 AGCCCAGGCCCTGGAGTGCCAGG - Intronic
1144850493 17:18241703-18241725 CGCCATGGCCAGGGTGAGGCGGG + Exonic
1149600448 17:57889886-57889908 GGCCATGGCTGTGGTGTGCCTGG + Intronic
1152425535 17:80216643-80216665 CGCCATGGCCACAGTGTCCCAGG - Intronic
1152795257 17:82303345-82303367 CTCCATGGCCACGGATGGCCAGG + Intergenic
1152798005 17:82317380-82317402 AGCTGTGGCCATGGAGAGCCTGG + Intronic
1157846919 18:51012669-51012691 CTCTAGGGCAATGGAGTGCCAGG + Intronic
1160429907 18:78804146-78804168 CCCCATGGCCCCAGAGTGCCTGG - Intergenic
1161064131 19:2229255-2229277 CGCCATGTCCCTGGAGGGCACGG - Intronic
1161064134 19:2229262-2229284 CTCCAGGGACATGGCGTGCCTGG + Intronic
1162743028 19:12783859-12783881 CCCCATGGCCTTAGAGTGTCTGG - Intronic
1163005509 19:14394654-14394676 CGCCATCGCCGGGGACTGCCAGG + Intronic
1163110990 19:15160973-15160995 CGCCATGTCCTGGGACTGCCAGG + Exonic
1166002916 19:39888957-39888979 CACCATGGACGTGAAGTGCCTGG + Intronic
1166005703 19:39905209-39905231 CACCATGGACGTGAAGTGCCTGG + Intronic
1166694832 19:44846515-44846537 GGCCCGGGCCATGGAGGGCCCGG - Exonic
927141864 2:20136323-20136345 CACCATGTCCATGGAATGCAGGG - Intergenic
928201789 2:29251873-29251895 AGCCATGGCCAGGGAGTGCAGGG - Intronic
928430332 2:31213115-31213137 TGCAGTGGCCATGGAGTGCTGGG + Intronic
931321421 2:61177535-61177557 CGCCATGGCCAAGTGGGGCCAGG + Exonic
941489358 2:166124752-166124774 CGCCATGGCCACGGTGTGGCTGG + Intronic
947574377 2:231260981-231261003 GACCATGGCCAGGGTGTGCCTGG - Intronic
947905689 2:233760284-233760306 CGCCATGGCTGTGGAGTCCCAGG + Exonic
948837013 2:240630783-240630805 CTACATGGCCAAGGAGTTCCAGG + Exonic
948850279 2:240702293-240702315 CGCAATGGCCATGCCCTGCCTGG + Intergenic
1170627838 20:18043017-18043039 CAGCATGGCCATGGACTACCTGG + Intronic
1172773615 20:37395326-37395348 CCCCATGCCCATGCACTGCCTGG + Intronic
1175745221 20:61451770-61451792 CTCCCTGGCCGTGGTGTGCCAGG + Intronic
1175908416 20:62393086-62393108 CGCCATGGCGCTGGCCTGCCAGG - Intronic
1176022369 20:62968297-62968319 CGCCATGGCCATGCTGGGCAGGG - Exonic
1176257486 20:64159836-64159858 CGCCAGGGCCAGGGAGGGGCAGG - Intronic
1178911830 21:36680924-36680946 AGCCACGGCCAAGGAGTGCCTGG + Intergenic
1179522335 21:41953630-41953652 CGCCATGGCCATGGCCCGGCTGG - Exonic
1181167787 22:20992683-20992705 CCTCATGGCCATGAAGGGCCAGG - Intronic
1181170892 22:21009283-21009305 CGTCATGGCCATGGAGACCTGGG + Intergenic
1181886275 22:26024673-26024695 CGCCATGGCAATGATGGGCCCGG - Intronic
1183785727 22:40028125-40028147 CGCCTTGGCCATGGAGCCCTTGG + Intronic
1183931027 22:41236391-41236413 GGGCATGGACATGGTGTGCCTGG + Intronic
949829923 3:8203117-8203139 CTCAAGGCCCATGGAGTGCCTGG + Intergenic
950270089 3:11606994-11607016 CACCATGGCCATGCTGTGTCCGG - Intronic
961557857 3:127708848-127708870 GGCCATGGCCATGGGCTGCGTGG + Intronic
962578819 3:136779051-136779073 CCCCATGGCAAGGGAGTGGCTGG - Intergenic
965565734 3:170115650-170115672 GGCTATGGCCATGAAGTGCCAGG + Intronic
966411869 3:179653216-179653238 CGCCGAGGCCATGCAGCGCCGGG + Exonic
968581832 4:1398879-1398901 TGCCATGGCAATGGTGTGCCTGG - Intergenic
969493481 4:7512888-7512910 CTCCAAGGCCATGGAGGGGCAGG - Intronic
974066160 4:57079525-57079547 TGCATTGGCCTTGGAGTGCCAGG - Intronic
979069344 4:116181932-116181954 TGCCATAGCCAAGGAATGCCTGG - Intergenic
982206544 4:153001197-153001219 TGCCATGGCCAGGGAGTACTGGG + Intergenic
985198695 4:187461649-187461671 CGCCAGGGCCAAAGAGTGCACGG - Intergenic
985440915 4:189981911-189981933 CGTCTTGGTGATGGAGTGCCTGG + Intergenic
986420367 5:7574491-7574513 GGCAATGGGCATGGAGTACCTGG + Intronic
987235406 5:15936958-15936980 CGACACGGGCCTGGAGTGCCTGG + Exonic
992910776 5:81394102-81394124 CGCCCTGGCCATGGAGCGGCCGG - Exonic
994517912 5:100794029-100794051 CAGCAGGGCCATGGAGTGTCAGG - Intergenic
998045812 5:138985788-138985810 AGCCATGGCCATGGGGTGGGAGG - Intronic
999382046 5:151128130-151128152 GGGCATGGCCTTGGGGTGCCAGG - Intronic
1001381470 5:171309285-171309307 CGGCGCGGCCATGGAGCGCCCGG - Exonic
1002899630 6:1400067-1400089 AGACATGGCCAGGGAGGGCCAGG + Intergenic
1002998572 6:2309868-2309890 CTCCATGACCATAGAGAGCCAGG - Intergenic
1004288528 6:14345609-14345631 TCCCATGGCCATAGAGCGCCTGG + Intergenic
1006446763 6:34084124-34084146 AGCCAAGGCCATGGAGGGCGAGG + Intronic
1012548868 6:100449724-100449746 CGCCGTGGCGGTGGAATGCCCGG + Intronic
1017352534 6:153459177-153459199 GGCCATGGCCCTGGTGTACCAGG + Intergenic
1017778366 6:157697167-157697189 AGCCAAGGGTATGGAGTGCCAGG - Intergenic
1020279509 7:6643167-6643189 GGCCATGGCACTGGAGTCCCCGG + Intronic
1023869735 7:44256824-44256846 GGCCCTGGCCAGGGAGTCCCAGG - Intronic
1026548288 7:71344327-71344349 CCCCTGAGCCATGGAGTGCCTGG - Intronic
1026841517 7:73671866-73671888 CCCCAGGGCCATGGTGTCCCTGG - Exonic
1027267791 7:76503718-76503740 GGCCAGAGCCATGGAGGGCCGGG + Intronic
1027319603 7:77003580-77003602 GGCCAGGGCCATGGAGGGCTGGG + Intergenic
1027655820 7:80929872-80929894 AGACATGGCCATGGCCTGCCTGG - Intergenic
1029643011 7:101832888-101832910 CGCCATGGCCATGCAGGGAGGGG + Intronic
1034843214 7:154418925-154418947 CGCCATAGCCCTGGAGGGTCTGG - Intronic
1035497106 8:61852-61874 CACCATGGCTTTGGAGTGCCTGG - Intergenic
1039914948 8:41852810-41852832 TGCCCTGGCCATCAAGTGCCTGG + Intronic
1040702082 8:50078374-50078396 TTCCATGGTCATGGAATGCCGGG - Intronic
1042128310 8:65560709-65560731 AGCCGTGGCCACGGAGTGCCTGG + Intergenic
1048290252 8:133175774-133175796 CCCCATGGCCCTGCAGTGGCTGG + Intergenic
1048976321 8:139674877-139674899 AGCCATGTCCCTGGGGTGCCAGG - Intronic
1049201377 8:141342151-141342173 CGCCATAGCCATGGAGTCCAGGG + Intergenic
1049774006 8:144396413-144396435 CCCCATGGCCATCGACGGCCCGG - Exonic
1052043479 9:23767974-23767996 GACCATGGCAATGGAGTGGCTGG - Intronic
1052963281 9:34318967-34318989 CACCAAGGACATGGAGTGCATGG + Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1061230236 9:129311767-129311789 AGCCATGCCCAGGGAGGGCCGGG + Intergenic
1062218616 9:135402601-135402623 CCCCATGGCGAGGGAGCGCCTGG - Intergenic
1062245143 9:135562304-135562326 CGCCATGGCCATGGAGTGCCAGG - Exonic
1062249856 9:135588603-135588625 CACCATGGCCATGGAGTACCAGG - Intergenic
1062741471 9:138177843-138177865 CGTCATGGTGATGGAGTGCCTGG - Intergenic
1185832837 X:3317761-3317783 CACCATTGCAATGGAGTGTCTGG - Exonic
1186139680 X:6558413-6558435 CACCATGGCCCTGGATTTCCAGG - Intergenic
1189943240 X:46150064-46150086 TGCCATAGCCAAGGAATGCCTGG - Intergenic
1192196812 X:69034097-69034119 TGCCATGGCAATGGCCTGCCAGG - Intergenic
1194491910 X:94561143-94561165 CCCCATGGCCTGGGATTGCCAGG + Intergenic
1199442514 X:147884586-147884608 CTCCTTGGCCATGGAGTGGGAGG - Intergenic
1200086583 X:153610169-153610191 CGCCTTGGCCGGGGACTGCCTGG - Intergenic