ID: 1062248072

View in Genome Browser
Species Human (GRCh38)
Location 9:135579929-135579951
Sequence GTAAATAAATGGATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062248072_1062248076 -2 Left 1062248072 9:135579929-135579951 CCATTGTCCATCCATTTATTTAC No data
Right 1062248076 9:135579950-135579972 ACCAACAAATATTCATGGCATGG No data
1062248072_1062248075 -7 Left 1062248072 9:135579929-135579951 CCATTGTCCATCCATTTATTTAC No data
Right 1062248075 9:135579945-135579967 TATTTACCAACAAATATTCATGG No data
1062248072_1062248078 6 Left 1062248072 9:135579929-135579951 CCATTGTCCATCCATTTATTTAC No data
Right 1062248078 9:135579958-135579980 ATATTCATGGCATGGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062248072 Original CRISPR GTAAATAAATGGATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr