ID: 1062248717

View in Genome Browser
Species Human (GRCh38)
Location 9:135583718-135583740
Sequence CGGGTCCCTCCTCTCATCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062248717_1062248726 28 Left 1062248717 9:135583718-135583740 CCCGGGATGAGAGGAGGGACCCG No data
Right 1062248726 9:135583769-135583791 CGTGTCCACGCTGATGTCACGGG 0: 1
1: 0
2: 1
3: 1
4: 63
1062248717_1062248725 27 Left 1062248717 9:135583718-135583740 CCCGGGATGAGAGGAGGGACCCG No data
Right 1062248725 9:135583768-135583790 GCGTGTCCACGCTGATGTCACGG 0: 1
1: 0
2: 0
3: 6
4: 55
1062248717_1062248723 3 Left 1062248717 9:135583718-135583740 CCCGGGATGAGAGGAGGGACCCG No data
Right 1062248723 9:135583744-135583766 GTGCACACAATGAACCTGACAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1062248717_1062248727 29 Left 1062248717 9:135583718-135583740 CCCGGGATGAGAGGAGGGACCCG No data
Right 1062248727 9:135583770-135583792 GTGTCCACGCTGATGTCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062248717 Original CRISPR CGGGTCCCTCCTCTCATCCC GGG (reversed) Intergenic