ID: 1062248718

View in Genome Browser
Species Human (GRCh38)
Location 9:135583719-135583741
Sequence CCGGGTCCCTCCTCTCATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062248718_1062248727 28 Left 1062248718 9:135583719-135583741 CCGGGATGAGAGGAGGGACCCGG No data
Right 1062248727 9:135583770-135583792 GTGTCCACGCTGATGTCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1062248718_1062248725 26 Left 1062248718 9:135583719-135583741 CCGGGATGAGAGGAGGGACCCGG No data
Right 1062248725 9:135583768-135583790 GCGTGTCCACGCTGATGTCACGG 0: 1
1: 0
2: 0
3: 6
4: 55
1062248718_1062248726 27 Left 1062248718 9:135583719-135583741 CCGGGATGAGAGGAGGGACCCGG No data
Right 1062248726 9:135583769-135583791 CGTGTCCACGCTGATGTCACGGG 0: 1
1: 0
2: 1
3: 1
4: 63
1062248718_1062248723 2 Left 1062248718 9:135583719-135583741 CCGGGATGAGAGGAGGGACCCGG No data
Right 1062248723 9:135583744-135583766 GTGCACACAATGAACCTGACAGG 0: 1
1: 0
2: 0
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062248718 Original CRISPR CCGGGTCCCTCCTCTCATCC CGG (reversed) Intergenic