ID: 1062248720

View in Genome Browser
Species Human (GRCh38)
Location 9:135583737-135583759
Sequence GGTTCATTGTGTGCACGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 67}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062248720_1062248730 21 Left 1062248720 9:135583737-135583759 CCCGGCCGTGCACACAATGAACC 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1062248730 9:135583781-135583803 GATGTCACGGGGCCTGTGGACGG 0: 1
1: 0
2: 0
3: 10
4: 160
1062248720_1062248732 23 Left 1062248720 9:135583737-135583759 CCCGGCCGTGCACACAATGAACC 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1062248732 9:135583783-135583805 TGTCACGGGGCCTGTGGACGGGG 0: 1
1: 0
2: 0
3: 9
4: 110
1062248720_1062248727 10 Left 1062248720 9:135583737-135583759 CCCGGCCGTGCACACAATGAACC 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1062248727 9:135583770-135583792 GTGTCCACGCTGATGTCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1062248720_1062248729 17 Left 1062248720 9:135583737-135583759 CCCGGCCGTGCACACAATGAACC 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1062248729 9:135583777-135583799 CGCTGATGTCACGGGGCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 103
1062248720_1062248726 9 Left 1062248720 9:135583737-135583759 CCCGGCCGTGCACACAATGAACC 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1062248726 9:135583769-135583791 CGTGTCCACGCTGATGTCACGGG 0: 1
1: 0
2: 1
3: 1
4: 63
1062248720_1062248731 22 Left 1062248720 9:135583737-135583759 CCCGGCCGTGCACACAATGAACC 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1062248731 9:135583782-135583804 ATGTCACGGGGCCTGTGGACGGG 0: 1
1: 0
2: 1
3: 7
4: 116
1062248720_1062248725 8 Left 1062248720 9:135583737-135583759 CCCGGCCGTGCACACAATGAACC 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1062248725 9:135583768-135583790 GCGTGTCCACGCTGATGTCACGG 0: 1
1: 0
2: 0
3: 6
4: 55
1062248720_1062248733 24 Left 1062248720 9:135583737-135583759 CCCGGCCGTGCACACAATGAACC 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1062248733 9:135583784-135583806 GTCACGGGGCCTGTGGACGGGGG 0: 1
1: 0
2: 1
3: 7
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062248720 Original CRISPR GGTTCATTGTGTGCACGGCC GGG (reversed) Intergenic