ID: 1062248722

View in Genome Browser
Species Human (GRCh38)
Location 9:135583742-135583764
Sequence TGTCAGGTTCATTGTGTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 175}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062248722_1062248736 30 Left 1062248722 9:135583742-135583764 CCGTGCACACAATGAACCTGACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1062248736 9:135583795-135583817 TGTGGACGGGGGCCTGTGGACGG 0: 1
1: 0
2: 1
3: 33
4: 325
1062248722_1062248733 19 Left 1062248722 9:135583742-135583764 CCGTGCACACAATGAACCTGACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1062248733 9:135583784-135583806 GTCACGGGGCCTGTGGACGGGGG 0: 1
1: 0
2: 1
3: 7
4: 173
1062248722_1062248732 18 Left 1062248722 9:135583742-135583764 CCGTGCACACAATGAACCTGACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1062248732 9:135583783-135583805 TGTCACGGGGCCTGTGGACGGGG 0: 1
1: 0
2: 0
3: 9
4: 110
1062248722_1062248727 5 Left 1062248722 9:135583742-135583764 CCGTGCACACAATGAACCTGACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1062248727 9:135583770-135583792 GTGTCCACGCTGATGTCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1062248722_1062248725 3 Left 1062248722 9:135583742-135583764 CCGTGCACACAATGAACCTGACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1062248725 9:135583768-135583790 GCGTGTCCACGCTGATGTCACGG 0: 1
1: 0
2: 0
3: 6
4: 55
1062248722_1062248726 4 Left 1062248722 9:135583742-135583764 CCGTGCACACAATGAACCTGACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1062248726 9:135583769-135583791 CGTGTCCACGCTGATGTCACGGG 0: 1
1: 0
2: 1
3: 1
4: 63
1062248722_1062248730 16 Left 1062248722 9:135583742-135583764 CCGTGCACACAATGAACCTGACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1062248730 9:135583781-135583803 GATGTCACGGGGCCTGTGGACGG 0: 1
1: 0
2: 0
3: 10
4: 160
1062248722_1062248731 17 Left 1062248722 9:135583742-135583764 CCGTGCACACAATGAACCTGACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1062248731 9:135583782-135583804 ATGTCACGGGGCCTGTGGACGGG 0: 1
1: 0
2: 1
3: 7
4: 116
1062248722_1062248734 26 Left 1062248722 9:135583742-135583764 CCGTGCACACAATGAACCTGACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1062248734 9:135583791-135583813 GGCCTGTGGACGGGGGCCTGTGG 0: 1
1: 0
2: 1
3: 50
4: 473
1062248722_1062248729 12 Left 1062248722 9:135583742-135583764 CCGTGCACACAATGAACCTGACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1062248729 9:135583777-135583799 CGCTGATGTCACGGGGCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062248722 Original CRISPR TGTCAGGTTCATTGTGTGCA CGG (reversed) Intergenic