ID: 1062248723

View in Genome Browser
Species Human (GRCh38)
Location 9:135583744-135583766
Sequence GTGCACACAATGAACCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062248711_1062248723 23 Left 1062248711 9:135583698-135583720 CCACTACTACATCATGAACACCC No data
Right 1062248723 9:135583744-135583766 GTGCACACAATGAACCTGACAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1062248717_1062248723 3 Left 1062248717 9:135583718-135583740 CCCGGGATGAGAGGAGGGACCCG No data
Right 1062248723 9:135583744-135583766 GTGCACACAATGAACCTGACAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1062248718_1062248723 2 Left 1062248718 9:135583719-135583741 CCGGGATGAGAGGAGGGACCCGG No data
Right 1062248723 9:135583744-135583766 GTGCACACAATGAACCTGACAGG 0: 1
1: 0
2: 0
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062248723 Original CRISPR GTGCACACAATGAACCTGAC AGG Intergenic