ID: 1062248727

View in Genome Browser
Species Human (GRCh38)
Location 9:135583770-135583792
Sequence GTGTCCACGCTGATGTCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062248718_1062248727 28 Left 1062248718 9:135583719-135583741 CCGGGATGAGAGGAGGGACCCGG No data
Right 1062248727 9:135583770-135583792 GTGTCCACGCTGATGTCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1062248720_1062248727 10 Left 1062248720 9:135583737-135583759 CCCGGCCGTGCACACAATGAACC 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1062248727 9:135583770-135583792 GTGTCCACGCTGATGTCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1062248722_1062248727 5 Left 1062248722 9:135583742-135583764 CCGTGCACACAATGAACCTGACA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 1062248727 9:135583770-135583792 GTGTCCACGCTGATGTCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1062248717_1062248727 29 Left 1062248717 9:135583718-135583740 CCCGGGATGAGAGGAGGGACCCG No data
Right 1062248727 9:135583770-135583792 GTGTCCACGCTGATGTCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1062248721_1062248727 9 Left 1062248721 9:135583738-135583760 CCGGCCGTGCACACAATGAACCT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1062248727 9:135583770-135583792 GTGTCCACGCTGATGTCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062248727 Original CRISPR GTGTCCACGCTGATGTCACG GGG Intergenic