ID: 1062249315

View in Genome Browser
Species Human (GRCh38)
Location 9:135586333-135586355
Sequence CCTCCCGGAGGCTCCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 9, 3: 62, 4: 467}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062249315_1062249328 25 Left 1062249315 9:135586333-135586355 CCTGCCCTGGAGCCTCCGGGAGG 0: 1
1: 0
2: 9
3: 62
4: 467
Right 1062249328 9:135586381-135586403 GTAGCCAGGGAGGCTCACTTTGG 0: 1
1: 0
2: 3
3: 9
4: 152
1062249315_1062249320 -9 Left 1062249315 9:135586333-135586355 CCTGCCCTGGAGCCTCCGGGAGG 0: 1
1: 0
2: 9
3: 62
4: 467
Right 1062249320 9:135586347-135586369 TCCGGGAGGAGCCAGCGCTGCGG 0: 1
1: 0
2: 0
3: 16
4: 271
1062249315_1062249324 11 Left 1062249315 9:135586333-135586355 CCTGCCCTGGAGCCTCCGGGAGG 0: 1
1: 0
2: 9
3: 62
4: 467
Right 1062249324 9:135586367-135586389 CGGACACCTTGGCTGTAGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 133
1062249315_1062249322 0 Left 1062249315 9:135586333-135586355 CCTGCCCTGGAGCCTCCGGGAGG 0: 1
1: 0
2: 9
3: 62
4: 467
Right 1062249322 9:135586356-135586378 AGCCAGCGCTGCGGACACCTTGG 0: 1
1: 0
2: 5
3: 70
4: 658
1062249315_1062249325 12 Left 1062249315 9:135586333-135586355 CCTGCCCTGGAGCCTCCGGGAGG 0: 1
1: 0
2: 9
3: 62
4: 467
Right 1062249325 9:135586368-135586390 GGACACCTTGGCTGTAGCCAGGG 0: 1
1: 0
2: 0
3: 22
4: 153
1062249315_1062249326 15 Left 1062249315 9:135586333-135586355 CCTGCCCTGGAGCCTCCGGGAGG 0: 1
1: 0
2: 9
3: 62
4: 467
Right 1062249326 9:135586371-135586393 CACCTTGGCTGTAGCCAGGGAGG 0: 1
1: 0
2: 1
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062249315 Original CRISPR CCTCCCGGAGGCTCCAGGGC AGG (reversed) Intergenic