ID: 1062252323

View in Genome Browser
Species Human (GRCh38)
Location 9:135604607-135604629
Sequence GCACGGCCAGGGGTGCGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062252323_1062252338 14 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252338 9:135604644-135604666 CCTCATGAGGTGGGGGCGTTTGG No data
1062252323_1062252341 20 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252341 9:135604650-135604672 GAGGTGGGGGCGTTTGGTAGGGG No data
1062252323_1062252343 28 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252343 9:135604658-135604680 GGCGTTTGGTAGGGGTTCCCGGG No data
1062252323_1062252333 4 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252333 9:135604634-135604656 GGGACACACTCCTCATGAGGTGG No data
1062252323_1062252345 30 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252345 9:135604660-135604682 CGTTTGGTAGGGGTTCCCGGGGG No data
1062252323_1062252332 1 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252332 9:135604631-135604653 TGGGGGACACACTCCTCATGAGG No data
1062252323_1062252335 6 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252335 9:135604636-135604658 GACACACTCCTCATGAGGTGGGG No data
1062252323_1062252334 5 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252334 9:135604635-135604657 GGACACACTCCTCATGAGGTGGG No data
1062252323_1062252336 7 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252336 9:135604637-135604659 ACACACTCCTCATGAGGTGGGGG No data
1062252323_1062252344 29 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252344 9:135604659-135604681 GCGTTTGGTAGGGGTTCCCGGGG No data
1062252323_1062252340 19 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252340 9:135604649-135604671 TGAGGTGGGGGCGTTTGGTAGGG No data
1062252323_1062252339 18 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252339 9:135604648-135604670 ATGAGGTGGGGGCGTTTGGTAGG No data
1062252323_1062252342 27 Left 1062252323 9:135604607-135604629 CCAAAGCGCACCCCTGGCCGTGC No data
Right 1062252342 9:135604657-135604679 GGGCGTTTGGTAGGGGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062252323 Original CRISPR GCACGGCCAGGGGTGCGCTT TGG (reversed) Intergenic