ID: 1062254640

View in Genome Browser
Species Human (GRCh38)
Location 9:135615169-135615191
Sequence CCTGCTGGGGCTACACAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062254622_1062254640 29 Left 1062254622 9:135615117-135615139 CCTGCTGACCATGCTCAGTGCCG No data
Right 1062254640 9:135615169-135615191 CCTGCTGGGGCTACACAGCCGGG No data
1062254627_1062254640 9 Left 1062254627 9:135615137-135615159 CCGAACCTGGGGCCTGAGAGCCC No data
Right 1062254640 9:135615169-135615191 CCTGCTGGGGCTACACAGCCGGG No data
1062254624_1062254640 21 Left 1062254624 9:135615125-135615147 CCATGCTCAGTGCCGAACCTGGG No data
Right 1062254640 9:135615169-135615191 CCTGCTGGGGCTACACAGCCGGG No data
1062254632_1062254640 -3 Left 1062254632 9:135615149-135615171 CCTGAGAGCCCAGAGGGTGGCCT No data
Right 1062254640 9:135615169-135615191 CCTGCTGGGGCTACACAGCCGGG No data
1062254628_1062254640 4 Left 1062254628 9:135615142-135615164 CCTGGGGCCTGAGAGCCCAGAGG No data
Right 1062254640 9:135615169-135615191 CCTGCTGGGGCTACACAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062254640 Original CRISPR CCTGCTGGGGCTACACAGCC GGG Intergenic
No off target data available for this crispr