ID: 1062257608

View in Genome Browser
Species Human (GRCh38)
Location 9:135635821-135635843
Sequence ACGTGGGAATGGATTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062257608 Original CRISPR ACGTGGGAATGGATTGAAGC TGG (reversed) Intronic
901380368 1:8869651-8869673 ACATGAGAATCGCTTGAAGCTGG - Intronic
903644045 1:24880425-24880447 ACTGGGTAATGGATAGAAGCTGG - Intergenic
903807997 1:26019103-26019125 ACATGAGAATTGCTTGAAGCTGG - Intergenic
904595382 1:31641357-31641379 CTGTGAGAATGGATTGAAGCAGG - Intronic
904626401 1:31807293-31807315 GCATGGGAATTGCTTGAAGCTGG + Intronic
905322885 1:37130274-37130296 ATGTGGGAGTGGATTGGAGTGGG - Intergenic
905467597 1:38167048-38167070 AGGTGGGAATGGAGTGAGGAGGG + Intergenic
906417249 1:45630042-45630064 ACGGGAGAATGGCTTGAACCCGG - Intronic
907244357 1:53098465-53098487 ATGTGTGAATGCATTGAGGCAGG - Intronic
907613348 1:55895631-55895653 AAGTGGGACTGGATTGAGGAAGG - Intergenic
910501155 1:87892003-87892025 AGATGGGTATGGATTGAATCTGG - Intergenic
911608967 1:99939706-99939728 ACGTGAGAATTGCTTGAACCCGG - Intergenic
911713004 1:101096710-101096732 ACTGGGGAATGGGTTGAGGCTGG - Intergenic
914921279 1:151849123-151849145 ACATGAGAATCGATTGAACCCGG + Intronic
914938765 1:152003734-152003756 ATGTGAGAATGGGGTGAAGCTGG + Intergenic
915170446 1:153973654-153973676 ACTCTGGAATGGACTGAAGCTGG - Exonic
915251871 1:154596334-154596356 ACAGGAGAATTGATTGAAGCTGG - Intronic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
920093100 1:203468168-203468190 ACGGGAGAATGGCTTGAACCCGG - Intergenic
920933963 1:210413914-210413936 AAGGGGTAATGGATAGAAGCTGG - Intronic
924138995 1:241002357-241002379 GCATGGGAATGGCTTGAACCCGG + Intronic
1062808506 10:443645-443667 ATGTGGGATTGGGTTGCAGCAGG - Intronic
1063133001 10:3194705-3194727 ACGGGAAGATGGATTGAAGCCGG + Intergenic
1063258834 10:4360346-4360368 ACTTGGGAATAGCTTGAACCTGG + Intergenic
1064304105 10:14149849-14149871 ACGTGAGAATGGACTAAAACAGG - Intronic
1065510191 10:26470770-26470792 CCGTGGGTTTGGATAGAAGCAGG - Intronic
1070138972 10:73722123-73722145 ACGTGAGAATTGCTTGAAGCTGG - Intergenic
1071890742 10:90004076-90004098 ACGTGAGAATCGCTTGAACCTGG + Intergenic
1076007812 10:126962089-126962111 GCAGGGGAATGGATTGAATCCGG - Intronic
1077088923 11:769412-769434 ACGTGAGAATTGCTTGAACCTGG - Exonic
1081059814 11:38460655-38460677 ACATGGGAATTGCTTGAACCTGG + Intergenic
1081479467 11:43471595-43471617 CCGTGGGAAGGGATGAAAGCTGG - Intronic
1081631677 11:44693922-44693944 AGGTGGGAGGGGATTGAGGCCGG - Intergenic
1081855274 11:46299416-46299438 ATGTGGGAAGGGAGTGATGCAGG - Intronic
1082066130 11:47901966-47901988 AAGAGGCAATGGATTGAAGCTGG - Intergenic
1085828377 11:79872766-79872788 ACGTGAGAATGGAGGGAGGCAGG + Intergenic
1087830820 11:102818487-102818509 ACGGGGGAATGGAATCAAGTTGG - Intergenic
1087875362 11:103349084-103349106 GCGTGAGAATGGATTAATGCAGG + Intronic
1089671836 11:120062214-120062236 GCGTCGGGAGGGATTGAAGCTGG + Intergenic
1091406570 12:213202-213224 ATGTGGGTGTGGACTGAAGCAGG - Intronic
1092212467 12:6656267-6656289 ACGTGAGAATCGTTTGAACCTGG - Intronic
1092340148 12:7668820-7668842 ACATGAGAATGGCTTGAACCCGG - Intergenic
1094293672 12:28879809-28879831 ACATGGGAATGAATTCAAGTAGG - Intergenic
1094438928 12:30453378-30453400 ACATGGGAATTCATTGAAGGAGG + Intergenic
1095702711 12:45207295-45207317 ACGGGAGAATGGCTTGAACCTGG - Intergenic
1096402754 12:51320978-51321000 ACATGGGACTGAATTTAAGCTGG - Intronic
1099306627 12:80964842-80964864 ACTTGGTAATGGATTGAATATGG - Intronic
1100097391 12:91058010-91058032 ACATGGTAATGGATTGACCCAGG + Intergenic
1101667318 12:106831120-106831142 ACATGGTAATGGAGTGGAGCAGG - Intronic
1102092750 12:110206579-110206601 GCGTGGGAATCGCTTGAACCCGG + Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102500413 12:113348487-113348509 ACATGAGAATGGCTTGAACCTGG - Intronic
1107979608 13:45722051-45722073 TTTTAGGAATGGATTGAAGCTGG - Intergenic
1115212689 14:30983449-30983471 ACGGGGGAATCGCTTGAACCAGG + Intronic
1115821557 14:37218272-37218294 ACGTGAGAATTGCTTGAATCTGG - Intronic
1115967119 14:38903017-38903039 ACTTGGTAATGGATTGAATACGG + Intergenic
1118181026 14:63493416-63493438 ACTTGAGAGAGGATTGAAGCGGG - Intronic
1119860592 14:77933319-77933341 GCGTGTGAAGGGGTTGAAGCTGG + Exonic
1121139830 14:91531595-91531617 ACGTGAGAATTGCTTGAATCCGG - Intergenic
1124551270 15:30683165-30683187 ACGTGGCTATGCATTGAAACTGG + Intronic
1128198715 15:65785038-65785060 ACTTGGGAATTGCTTGAACCTGG + Intronic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1129306397 15:74667197-74667219 ATGTGGTAATGGATTAAAGTTGG + Intronic
1133097119 16:3455143-3455165 ACATGAGAATGGCTTGAACCCGG - Intronic
1133245815 16:4448120-4448142 AGGTGGGAATCGCTTGAACCTGG - Intronic
1134052930 16:11149693-11149715 ACATGAGAATGGCTTGAACCTGG + Intronic
1136378899 16:29882062-29882084 ACATGAGAATGGCTTGAACCTGG - Intronic
1141056407 16:80819247-80819269 ATGTGGTAATGGACTGGAGCTGG + Intergenic
1145003472 17:19321622-19321644 AAGTGGGAAGGGATAGTAGCTGG + Intronic
1145239033 17:21228815-21228837 ACGTGGGAATCACTTGAACCCGG + Intergenic
1145962358 17:28894528-28894550 ACATGAGAATGGCTTGAACCTGG + Intronic
1146321025 17:31846560-31846582 ACGTGAGAATTGCTTGAACCAGG - Intergenic
1147789563 17:43005216-43005238 ACGGGGGAATCGCTTGAACCCGG - Intergenic
1148216166 17:45835023-45835045 ACATGGGAATGAATTGAAATGGG + Exonic
1148649045 17:49236585-49236607 ACATGAGAATGGCTTGAACCTGG - Intergenic
1149928304 17:60724327-60724349 GCGTGGGAATTGCTTGAACCCGG + Intronic
1151259915 17:72908245-72908267 AGGTGTGAATGGGTTGAGGCTGG + Intronic
1152712529 17:81880361-81880383 ACGGGGGAATTGCTTGAACCTGG + Intergenic
1153856947 18:9159319-9159341 ATGTGGTAATGGATTACAGCTGG - Intronic
1157404999 18:47415220-47415242 GCGTGGAAATGGACTGAACCTGG + Intergenic
1158717161 18:59890597-59890619 ACATGAGAATGGCTTGAACCAGG + Intergenic
1158988334 18:62842455-62842477 AGGTGGGAATTGCTTGAACCCGG - Intronic
1160204308 18:76821094-76821116 ACGTGGGAATGGCTTGGATTTGG + Intronic
1168526586 19:57093363-57093385 ACGGGAGAATCGATTGAACCTGG + Intergenic
925016847 2:534432-534454 ACTGGGTAATGGATAGAAGCTGG - Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
927496708 2:23555984-23556006 AGGGGGGACTGGATTGCAGCAGG + Intronic
928105952 2:28470840-28470862 AGGTGAGAATGGAATGAATCAGG - Intronic
930506266 2:52285804-52285826 CCATGGGAATGGCTTGAACCTGG + Intergenic
932361651 2:71113185-71113207 ATGTGGTAATGGATTAGAGCTGG + Intronic
935864715 2:107374589-107374611 ATGTGGTAATGGATTAGAGCTGG + Intergenic
937428535 2:121819033-121819055 AAATGAGAATGGATTGAAACAGG - Intergenic
938582899 2:132663365-132663387 ACGTGAGAATTGCTTGAACCCGG - Intronic
940032160 2:149274930-149274952 TTGTGGGAATGGACTGAAGGAGG + Intergenic
941997138 2:171611506-171611528 ACGTGAGAATTGCTTGAACCTGG - Intergenic
943169483 2:184378887-184378909 ATGTGGTAATGTATTGGAGCTGG + Intergenic
946286370 2:218706609-218706631 ACGTGAGAATTGCTTGAACCTGG + Intergenic
1169774774 20:9240599-9240621 AAGTGGGCATGGCTTGGAGCTGG - Intronic
1171964733 20:31520921-31520943 CCGTGCCAATGGCTTGAAGCAGG + Intronic
1172019732 20:31905537-31905559 ACGTGGTAATGGAATGACACTGG - Intronic
1172974019 20:38893542-38893564 ACCTGGTGATAGATTGAAGCTGG + Intronic
1173015873 20:39225347-39225369 AGGGAAGAATGGATTGAAGCTGG + Intergenic
1173133616 20:40418410-40418432 AGGTGAGAATGGATTGAAGGGGG + Intergenic
1173816897 20:45995327-45995349 GCGTGGGAAGGGTTTGAGGCAGG + Intergenic
1180652689 22:17391893-17391915 ACGGGGGAATTGCTTGAACCTGG - Intronic
1182208976 22:28657783-28657805 ACGTGAGAATCGCTTGAACCTGG + Intronic
1182214651 22:28705847-28705869 ACCTGGGAATCGCTTGAACCCGG + Intronic
1182649301 22:31837793-31837815 ACGTGAGAATCGCTTGAACCTGG - Intronic
1183547997 22:38465610-38465632 ACGTGGGGCTGGAATGAGGCTGG - Intergenic
1183902845 22:41019476-41019498 GCGGGAGAATGGCTTGAAGCTGG + Intergenic
949540050 3:5025864-5025886 ACAAGAGAATGGATTGAACCAGG + Intergenic
949697731 3:6718810-6718832 ACGTAGTAATGGATTCAAGTAGG + Intergenic
950406026 3:12805379-12805401 ACATGGGAATCGCTTGAACCTGG - Intronic
950614984 3:14151002-14151024 ACAGGGGAATGGATTCAGGCTGG + Intronic
953007228 3:38989831-38989853 ACGGGGGAACGGATTGTAGGGGG - Intergenic
953675456 3:44998127-44998149 ACATGAGAATCGATTGAACCTGG - Intronic
954262237 3:49447823-49447845 ACATGAGAATCGATTGAACCTGG + Intergenic
955067455 3:55545457-55545479 ACGTGGGAATGCATGGGATCAGG + Intronic
955280002 3:57585420-57585442 ATGTTGAAATGGATTTAAGCAGG - Intronic
957611574 3:82473522-82473544 ACATGAGAATCGCTTGAAGCCGG + Intergenic
959312219 3:104753624-104753646 ATGGGGGAAAGGATAGAAGCAGG - Intergenic
961600278 3:128055486-128055508 AGGAGAGAATGAATTGAAGCAGG - Intronic
961629523 3:128285738-128285760 ACGTGGGACTGGCCTGACGCTGG - Intronic
963513807 3:146282330-146282352 AAGTGGGAATTGATAGAAGAAGG + Intergenic
967023892 3:185547045-185547067 AGGTGGGAATTGTTTGAACCCGG + Intronic
967185786 3:186943541-186943563 ACAGGGGAATGGCTTGAACCCGG - Intronic
967942720 3:194778702-194778724 AAGTGGGAATGAATTGGAGGAGG + Intergenic
968454736 4:691499-691521 AGGTGGGAATTGATTAAACCCGG + Intergenic
968811601 4:2802012-2802034 ACGTGAGAATTGCTTGAAACTGG + Intronic
968857580 4:3138705-3138727 ACGTGGGAATCACTTGAACCTGG - Intronic
970523673 4:16910635-16910657 ACTTGGGAATCGCTTGAACCCGG - Intergenic
971324315 4:25631648-25631670 ATGTGGGATTGGATTGGAGGGGG + Intergenic
971324323 4:25631671-25631693 ATGTGGGATTGGATTGGAGGGGG + Intergenic
971394052 4:26212528-26212550 AGGTGGGAATCGCTTGAACCTGG - Intronic
971497451 4:27282092-27282114 AGGGGGGAATGGATTGAAAATGG + Intergenic
971714480 4:30158091-30158113 ACGTGAGAATAGCTTGAACCCGG - Intergenic
972884192 4:43465157-43465179 ACATGGGAATCGCTTGAACCCGG - Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
976862790 4:89686981-89687003 ATTTGGGCATGGCTTGAAGCAGG + Intergenic
981735621 4:147947494-147947516 ACATGAGAATTGATTGAACCTGG - Intronic
982816372 4:159890349-159890371 ATGTGGTAATGGATTCGAGCTGG - Intergenic
983502918 4:168520230-168520252 ACGGGAGAATGGCTTGAATCCGG + Intronic
984084744 4:175294875-175294897 AGGTGGGAAAGTATTAAAGCAGG + Intergenic
984231582 4:177106995-177107017 AAGTGTGAATGAATTTAAGCAGG - Intergenic
986114243 5:4754075-4754097 ATGTGGTAATGGATTAGAGCTGG - Intergenic
986174060 5:5337005-5337027 ATGTGGCAAAGGACTGAAGCCGG + Intergenic
988637640 5:33004274-33004296 ACATGAGAATGGCTTGAACCCGG - Intergenic
990816567 5:59792447-59792469 AAGTGGGCATGGAGTGAAGGAGG + Intronic
991044469 5:62208657-62208679 ACGTGGGATTGGGCTGAGGCTGG - Intergenic
994484211 5:100374699-100374721 ACCTGGGAATTGCTTGAACCTGG + Intergenic
996904204 5:128578716-128578738 ACAGGGGAATGGATGGTAGCTGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1001117330 5:168950709-168950731 ACGTGGTAATGTTTTGAGGCAGG - Intronic
1001502289 5:172246855-172246877 ACGGGAGAATGGCTTGAATCTGG - Intronic
1001900994 5:175429505-175429527 ATGTGGTAATGGATTCAAGTTGG + Intergenic
1001913987 5:175544014-175544036 ACATGGGAATAGCTTGAACCCGG + Intergenic
1002172506 5:177383390-177383412 ACGGGGGAATGGAGAGAAACAGG + Intronic
1003989967 6:11476504-11476526 GCGTGGGAATGGATTGTGGAGGG + Intergenic
1005638364 6:27772275-27772297 ACGTGGGACAGGATTGTAGCCGG - Intergenic
1007358646 6:41340253-41340275 GCATGGGAATGGGTTGAACCTGG - Intronic
1009246465 6:61244449-61244471 GCGGGAGAATGGATTGAACCTGG + Intergenic
1009691612 6:67041526-67041548 ACGTGGCACTGGATTTGAGCTGG + Intergenic
1012199635 6:96389616-96389638 AGGAGGTAATGGAATGAAGCTGG + Intergenic
1014556512 6:122847496-122847518 ACAGGAGAATGGATTGAACCTGG - Intergenic
1016521994 6:144955911-144955933 AGGTGGGAAGGGATTGTTGCTGG + Intergenic
1018608180 6:165620925-165620947 ACAGGGGAATCGATTGAACCTGG + Intronic
1021533352 7:21674452-21674474 GCATGGGAATTGTTTGAAGCTGG - Intronic
1022440446 7:30428741-30428763 ACGTGGGACTGGGTGGATGCTGG - Intronic
1022581581 7:31560455-31560477 AGGTTGGAAAGGGTTGAAGCGGG + Intronic
1022599250 7:31741342-31741364 ATATGGTAAAGGATTGAAGCTGG - Intergenic
1022959405 7:35412313-35412335 ACGTGGGAATGGATTTGAGGAGG + Intergenic
1023335489 7:39164888-39164910 ACTTGGGAATGGAGTGAATGAGG - Intronic
1027850313 7:83443213-83443235 ACGGGGTATTGGATTGAAGAAGG + Intronic
1030823645 7:114127070-114127092 ACGTGAGATTGGAATGAAACAGG - Intronic
1032314280 7:130820504-130820526 ACGGGGGAATTGCTTGAACCCGG - Intergenic
1032446373 7:131987282-131987304 ACTTGGTAATGGATTGAATTGGG + Intergenic
1032499291 7:132388009-132388031 CGGTGGGAATTGATTGAAGCTGG - Intronic
1032607037 7:133366932-133366954 CCGTGGCAATGGAGTGAAGGAGG + Intronic
1034079658 7:148264786-148264808 GCATGGGAATGGCTTGAACCTGG - Intronic
1035990879 8:4489002-4489024 ACAGGGGAATTGCTTGAAGCTGG - Intronic
1037642592 8:20761310-20761332 GCATGGGAATGGCTTGAACCTGG - Intergenic
1038052378 8:23826119-23826141 ACGTGGGATTGGGTTGGAGGAGG + Intergenic
1038777549 8:30544604-30544626 ACCTGGGCATGCAGTGAAGCGGG - Exonic
1039673561 8:39633292-39633314 ACCTGGCAATGGGTTGAAGCGGG + Intronic
1039836053 8:41257065-41257087 ACTTGGGAATGGATTGAGGGTGG - Intergenic
1040773617 8:51011470-51011492 GCAGGGGAATCGATTGAAGCTGG - Intergenic
1041737095 8:61122789-61122811 AGCTGGGAAAGGATTGAAGCTGG - Intronic
1043337213 8:79191281-79191303 ACGTGGGAATGTAAAGAAGCAGG - Intergenic
1045434621 8:102149584-102149606 ACTTGGGATTGCATTGAATCTGG - Intergenic
1045848237 8:106661962-106661984 ATGTGGGAAGGAATAGAAGCAGG + Intronic
1048573733 8:135675345-135675367 GCATGGGAATGGCTTGAACCTGG - Intergenic
1048797292 8:138162760-138162782 ACGTGGGAATGAACCAAAGCTGG - Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1052175670 9:25459910-25459932 ACATGGGAATTGCTTGAACCTGG - Intergenic
1053236787 9:36462362-36462384 AGGAGGGTAAGGATTGAAGCAGG - Intronic
1053743776 9:41171655-41171677 ACAAGGGAATCGCTTGAAGCTGG + Intronic
1054684567 9:68259603-68259625 ACAAGGGAATCGCTTGAAGCTGG - Intronic
1056929866 9:90865399-90865421 GCATGAGAATGGCTTGAAGCTGG - Intronic
1057249921 9:93492902-93492924 AAGTGGGATGGGAGTGAAGCAGG + Intronic
1058360466 9:104140622-104140644 ACATTGGAAAGGATTGAATCTGG + Exonic
1058678229 9:107419650-107419672 AAGTGAGAGTGGATTGAAGCAGG - Intergenic
1059835862 9:118151535-118151557 ACGGGGGCAGGGATTGAAGCTGG + Intergenic
1060592250 9:124825055-124825077 ACATGGGAATCACTTGAAGCTGG - Intergenic
1061305156 9:129728209-129728231 AAGTGGGAATGGATTGAGCTTGG + Intergenic
1061364795 9:130166819-130166841 ACATGAGAATCGCTTGAAGCCGG - Intergenic
1061564429 9:131428488-131428510 ACATGAGAATTGCTTGAAGCCGG - Intronic
1061603876 9:131693745-131693767 ACTTGGGAATGGATGGGATCTGG - Intronic
1061887912 9:133602038-133602060 AGCTGGGAATGGTTTTAAGCAGG + Intergenic
1062257608 9:135635821-135635843 ACGTGGGAATGGATTGAAGCTGG - Intronic
1187596780 X:20782075-20782097 ATGTGGGAATTGATTCAAGAGGG + Intergenic
1188528845 X:31115131-31115153 ATTTGGGAATGTATTGAGGCAGG + Intronic
1192457567 X:71289863-71289885 ACAGGGGAATGGCTTGAACCTGG - Intronic
1193103101 X:77637845-77637867 ACAGGAGAATGGATTGAACCTGG + Intronic
1193328401 X:80208156-80208178 ACCTGGGATTGGCTTGGAGCTGG - Intergenic
1194286519 X:92017601-92017623 ACATGAGAATGGCTTGAACCTGG + Intronic
1194562299 X:95437664-95437686 ACAGGGTAATGGATAGAAGCAGG - Intergenic
1194840802 X:98738929-98738951 ACATGAGAATTGCTTGAAGCTGG - Intergenic
1196528050 X:116750441-116750463 ACTTGGGCAAGGATTGAAGAGGG + Intergenic
1197188248 X:123613154-123613176 AGGTGGGAATGGAATGGAGAGGG + Intronic
1198814729 X:140577512-140577534 ACGGGAGAATCGCTTGAAGCTGG - Intergenic
1200604064 Y:5242158-5242180 ACATGAGAATGGCTTGAACCTGG + Intronic
1200964934 Y:9027220-9027242 AGATTGGAATGGATTGATGCTGG - Intergenic
1202148176 Y:21821566-21821588 AGATTGGAATGGATTGATGCTGG + Intergenic