ID: 1062258662

View in Genome Browser
Species Human (GRCh38)
Location 9:135645355-135645377
Sequence TAGTGTCAAGTGCTGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062258662_1062258666 12 Left 1062258662 9:135645355-135645377 CCTACCTCCAGCACTTGACACTA No data
Right 1062258666 9:135645390-135645412 CAGACCCTACCCTTATCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062258662 Original CRISPR TAGTGTCAAGTGCTGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr