ID: 1062261507

View in Genome Browser
Species Human (GRCh38)
Location 9:135665370-135665392
Sequence GGTCCCCGAGGGGGTCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062261507_1062261523 15 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261507_1062261531 30 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261507_1062261514 -3 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261514 9:135665390-135665412 ACCCCACCTCCTCTGAAGTCCGG 0: 1
1: 0
2: 0
3: 20
4: 221
1062261507_1062261525 18 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261525 9:135665411-135665433 GGCCCAACCCTGGGCGGAGGAGG 0: 1
1: 0
2: 3
3: 12
4: 277
1062261507_1062261520 8 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261520 9:135665401-135665423 TCTGAAGTCCGGCCCAACCCTGG 0: 1
1: 0
2: 0
3: 10
4: 95
1062261507_1062261521 9 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261521 9:135665402-135665424 CTGAAGTCCGGCCCAACCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 86
1062261507_1062261526 19 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261526 9:135665412-135665434 GCCCAACCCTGGGCGGAGGAGGG 0: 1
1: 0
2: 2
3: 18
4: 258
1062261507_1062261522 12 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261522 9:135665405-135665427 AAGTCCGGCCCAACCCTGGGCGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062261507 Original CRISPR GGTCCCCGAGGGGGTCAGAG GGG (reversed) Intronic
900387213 1:2416181-2416203 GGACCCCGAGGAGGGCAGGGTGG + Intergenic
900405871 1:2492782-2492804 GCTACCCCAGGGGGACAGAGAGG - Intronic
903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG + Intronic
903259051 1:22121419-22121441 GGTGCAGGAGGTGGTCAGAGTGG - Intronic
903496677 1:23773074-23773096 GGTTCCCCAGGTGGACAGAGCGG + Intergenic
903915644 1:26762289-26762311 GGTCCCCAGGGGGGTCAGTATGG + Exonic
904081942 1:27877735-27877757 GGTCCCAGAGAGGCCCAGAGAGG - Intronic
904592636 1:31623564-31623586 GGTCCCCCAGCTGGTCTGAGGGG - Exonic
905429554 1:37911564-37911586 GGTAGTGGAGGGGGTCAGAGTGG - Intronic
906975202 1:50562595-50562617 TGTACCCAAGGGGGTCAAAGAGG - Intronic
907270428 1:53287921-53287943 GGACCCCGAAGGGGACAGAATGG + Intronic
924560352 1:245153638-245153660 TGTCCCCGAGGAAGGCAGAGTGG + Intergenic
1065452897 10:25877384-25877406 GATCCCCAAGGTGGACAGAGTGG + Intergenic
1070536705 10:77384091-77384113 GATCTCCGCGGGGGTTAGAGAGG - Intronic
1071148934 10:82610096-82610118 GGCCCTCGATGGGGTGAGAGAGG - Intronic
1071297340 10:84231828-84231850 GGTACCCGAGCAGGTAAGAGTGG + Exonic
1073030077 10:100519263-100519285 GGCCCCCGCTGGGGTCAGATTGG + Intronic
1073352526 10:102830176-102830198 GGGCCCTGATGAGGTCAGAGTGG - Intergenic
1075664335 10:124219925-124219947 CGTCCCAGAGGGGGACAGGGAGG - Intergenic
1076364998 10:129916043-129916065 GGTCCCACAGGGGCTCCGAGGGG + Intronic
1078829657 11:14967590-14967612 GGTCTCAGAGAGGCTCAGAGTGG + Intronic
1083463517 11:62831106-62831128 GGTCACTGGGGGGGGCAGAGGGG + Exonic
1083593186 11:63907061-63907083 GGTCCCCGAGGCCTGCAGAGAGG - Intronic
1084661922 11:70551061-70551083 GGTCTCGGAGGGGGTGGGAGGGG - Intronic
1085318874 11:75562378-75562400 GGTGCGCGAGGGAGTAAGAGGGG + Exonic
1086375407 11:86195139-86195161 GGCCACCGAGGGGGTCGGGGAGG + Intergenic
1091454678 12:598275-598297 GGGCACCGAGGGGGTAAGTGCGG + Intronic
1092900548 12:13055759-13055781 GGCCCCCAAGGGGTTCTGAGGGG - Exonic
1100398728 12:94208514-94208536 AGTCCCGGAGGGGATCCGAGCGG - Intronic
1102890220 12:116552883-116552905 GGTCCCTGTGGGCGTCTGAGTGG - Intergenic
1104982652 12:132581195-132581217 GGACCCCAAGGGGGGCAGGGAGG - Intronic
1105003028 12:132703437-132703459 GGTCCCCTAAGGAGTCAGGGTGG + Intronic
1105725586 13:23159875-23159897 GGTCACAGAGGGGCTCGGAGTGG + Intergenic
1105997392 13:25685711-25685733 GGCACCAGAGGAGGTCAGAGGGG + Intronic
1108619570 13:52168225-52168247 GGTCCCCGAGGAGCTCTGTGGGG + Intergenic
1116688585 14:48075376-48075398 CGTCCCTGAAGGGCTCAGAGTGG + Intergenic
1117251799 14:53946703-53946725 GGTCCCCGAGGGCGGATGAGCGG + Intergenic
1119653979 14:76403666-76403688 GGTCCCTGAGAGTGCCAGAGAGG + Intronic
1120840528 14:89081284-89081306 GGTCCCTGAGGTGGTCAGCTGGG + Intergenic
1120997569 14:90428105-90428127 AGTCCCCAGGGAGGTCAGAGAGG + Intergenic
1125173431 15:36793036-36793058 GTTCACCGAGTGGGTAAGAGGGG - Intronic
1128161093 15:65423104-65423126 GGTCCCCGGCGGGGCCAGGGTGG - Intergenic
1129949068 15:79570172-79570194 GGTCCCTGGGTGGGGCAGAGGGG + Intergenic
1130133277 15:81161103-81161125 GGTCCCCCTGGGAGACAGAGGGG + Intronic
1133762862 16:8813764-8813786 GGATCCCCAGGAGGTCAGAGAGG + Intronic
1136103192 16:28010418-28010440 AGTCCCCAAGGGGGACACAGAGG + Intronic
1136397742 16:30002286-30002308 GGTCCCGGAGCAGGTCAGAGGGG + Intronic
1136413701 16:30091349-30091371 GGGCCTCGAAGGGGTCCGAGAGG + Intronic
1142259660 16:89036761-89036783 GGACCCCGAAGGGGACAGTGGGG - Intergenic
1143447244 17:7016796-7016818 GTTCCCAGAGAGGGGCAGAGGGG + Intronic
1144958979 17:19034281-19034303 GGCCCCAGAGGAGGGCAGAGTGG - Intronic
1144976180 17:19140243-19140265 GGCCCCAGAGGAGGGCAGAGTGG + Intronic
1145766335 17:27460614-27460636 GGAGCCGCAGGGGGTCAGAGGGG + Intronic
1146548010 17:33755875-33755897 GGTGCACGAGGAGGGCAGAGAGG + Intronic
1146912575 17:36658087-36658109 GGCCTCGGAGCGGGTCAGAGAGG - Intergenic
1146935203 17:36808704-36808726 GGTCCCCGGGAGGGCGAGAGGGG - Intergenic
1147614993 17:41822390-41822412 GGTCCACGAGGAGCTCTGAGGGG + Exonic
1147725065 17:42561965-42561987 GGTCCCAGCGGGGGTCCGATCGG + Intronic
1151983569 17:77528355-77528377 GGTCCCAGAGAGGAACAGAGGGG - Intergenic
1152786727 17:82252085-82252107 GCTCCTGGAGGGGGCCAGAGAGG + Intronic
1158725735 18:59969784-59969806 GATCCCCGAGCGGCTCGGAGTGG + Intergenic
1159864715 18:73690438-73690460 AGTCCCAGAGGAGGTCAGTGTGG + Intergenic
1161290382 19:3490896-3490918 GGTCCCTGAGTGGGTCAGGTAGG - Exonic
1161399338 19:4060470-4060492 GGTCCCTGAGAGGCTCAGAGAGG + Intronic
1161956495 19:7498795-7498817 GGTCTCCAAGGGAGACAGAGAGG + Intronic
1163612425 19:18308362-18308384 GGTCCCCAAGGGAGACAGAGAGG - Intronic
1165142090 19:33705706-33705728 GGTGCCCTAGGGGGGCAGAAAGG - Intronic
1165300232 19:34963936-34963958 GGACCGCGAGGGGGACAGTGAGG - Exonic
1165800448 19:38546318-38546340 GGTCCCCTCGGAGGTAAGAGGGG + Intronic
1167204993 19:48095442-48095464 GGTCAGCGCTGGGGTCAGAGGGG - Exonic
1167266511 19:48485545-48485567 TGGCTCCGAGGGGGTCAGGGGGG + Exonic
1167609832 19:50501728-50501750 GGCCCCTGAGGGCGACAGAGAGG - Intergenic
1168059756 19:53884286-53884308 GGACGCCGAGGGGGTGAGGGCGG - Intronic
927123388 2:19990021-19990043 GATCCCCGAGAGGGTCACGGCGG + Exonic
936058577 2:109279871-109279893 GGGCCCCTGGGGGGTGAGAGAGG + Intronic
937834711 2:126460677-126460699 GGTCCACGAGAGGGTCAGGCAGG - Intergenic
942120678 2:172773637-172773659 GGTCCGCGGGGGGGGCAGTGTGG - Intronic
943342170 2:186694248-186694270 GGTCCCCGCGGCCGCCAGAGCGG + Exonic
945314823 2:208360339-208360361 GGGCCCCGAGGGGCTCGGGGAGG - Intronic
948921464 2:241067882-241067904 GGTCCCTGAGGGCCTCAGGGTGG - Exonic
1173530826 20:43768134-43768156 GGTCCCTGAGGAGGAGAGAGAGG + Intergenic
1174272533 20:49380254-49380276 GGACACAGAGTGGGTCAGAGTGG + Intronic
1175418371 20:58816269-58816291 GGCCCCAGTGGGGGGCAGAGGGG + Intergenic
1175777690 20:61663503-61663525 TGCCGCCGAGTGGGTCAGAGGGG + Intronic
1175907214 20:62386814-62386836 GGCTCCCGAGGCGCTCAGAGGGG + Intergenic
1175923166 20:62459335-62459357 GGTCCCTGAGGGAGGCTGAGTGG - Intergenic
1177125935 21:17192888-17192910 GGACCCAGAGGCAGTCAGAGTGG + Intergenic
1180163225 21:46007164-46007186 GGGCCCCGTGGGGGTCTGCGTGG - Intergenic
1180194608 21:46185078-46185100 GGGCCCCGTCGGGCTCAGAGCGG - Intergenic
1181106654 22:20579628-20579650 GGACACCGAGTGGGCCAGAGAGG - Intronic
1182280572 22:29215791-29215813 GGTCACCGTGGGGGGCAGGGGGG - Intronic
1182420734 22:30247360-30247382 GGGCCCCAAGGGGCTCCGAGGGG + Intergenic
1182845906 22:33430755-33430777 GTTCACAGATGGGGTCAGAGTGG - Intronic
1183163937 22:36133326-36133348 GGGCCCTGATGGGGACAGAGTGG + Intergenic
1183294071 22:37019601-37019623 GGGACCCGCGGGGGTCTGAGGGG + Intronic
1183639305 22:39083532-39083554 AGCCCCAGAAGGGGTCAGAGGGG + Intronic
1184566232 22:45293808-45293830 AGGCCCAGAGGGGGTCAGAGTGG + Intronic
1184589943 22:45475427-45475449 GGACCCAGAGGAGGGCAGAGAGG + Intergenic
1184876158 22:47277088-47277110 GGTCCCCGAGTGAGTCAGTGGGG + Intergenic
953349327 3:42202775-42202797 AGTCCCCCAGGAGGACAGAGAGG - Intronic
954611613 3:51947345-51947367 GGTCCACCAGGAGGGCAGAGGGG + Intronic
961454271 3:127016489-127016511 GGTGCCCGAGTGGGACAGTGAGG - Intronic
964955717 3:162353529-162353551 AGTCCATGAGGGGGTCAGTGAGG + Intergenic
965549891 3:169953459-169953481 GATCCCAGAGGGGGAGAGAGAGG - Intergenic
968936323 4:3612314-3612336 GGTCCCTGAGGGGTTCAGGGCGG + Intergenic
969559680 4:7939335-7939357 GGTCCCCGTGTGCGTCAGAGGGG - Exonic
969621781 4:8282283-8282305 GGTCCCCAACGGGCTCAGTGTGG + Intronic
970256148 4:14172164-14172186 GGTAGTGGAGGGGGTCAGAGTGG + Intergenic
972345015 4:38185504-38185526 GGTCCAAGAGGGGGTTAGGGAGG + Intergenic
985604127 5:849577-849599 GGGCCCTGAGGGAGTCTGAGGGG - Intronic
986108628 5:4687514-4687536 GGTCCAAGAGGAGGTCAGAAAGG - Intergenic
997591659 5:135076931-135076953 GGTCCCCCAGCAGGCCAGAGCGG + Intronic
997758229 5:136420482-136420504 GGCCCCTGAGGAGGTCAGTGTGG + Intergenic
1002332766 5:178455742-178455764 GCTCCACGAGGAGGTCAGAGCGG + Intronic
1002399384 5:178983125-178983147 GGACCCCGAGCAGGCCAGAGGGG - Exonic
1004066450 6:12249830-12249852 CAACCCTGAGGGGGTCAGAGAGG - Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1007422567 6:41728527-41728549 AGTCCCTGAGGGGTGCAGAGTGG - Intronic
1007725497 6:43913441-43913463 CCTCCCCCAGAGGGTCAGAGGGG + Intergenic
1019047217 6:169158433-169158455 GGCCCCGGAGAGGGTCAGCGAGG - Intergenic
1019223433 6:170492961-170492983 GGGCCCCAAGGGGCCCAGAGGGG + Intergenic
1019333538 7:471901-471923 GGTCCCCTAGGGGCTCACAGTGG + Intergenic
1019560564 7:1654478-1654500 GATCCCCGAGGGGCTCACAGAGG + Intergenic
1020007154 7:4789076-4789098 GGTCCCTGTGAGGGTCAGGGAGG + Intronic
1020275017 7:6618740-6618762 GCTGCCCCAGGGAGTCAGAGTGG + Intronic
1026482459 7:70790414-70790436 GGTCCCGGATGGGGTCCCAGTGG - Exonic
1026850265 7:73719412-73719434 TGACCCCGAGTGGGTCCGAGGGG + Intronic
1033601169 7:142889218-142889240 GGCCCCTGAGAGGGGCAGAGAGG + Intergenic
1034263998 7:149772797-149772819 GGGCCCCGAGGGGAGGAGAGAGG - Intronic
1034271720 7:149806326-149806348 GCTCCCCGAGGGAGGCAGACTGG + Intergenic
1034419164 7:150979942-150979964 GGCCCCCGGGGGGGTGAGTGAGG - Intergenic
1035373595 7:158394118-158394140 GGTGTCCGTGGGGGACAGAGGGG - Intronic
1036285847 8:7443574-7443596 GGTCCCCGAGTGGGTCTGCATGG - Intronic
1036335626 8:7867955-7867977 GGTCCCCGAGTGGGTCTGCATGG + Intronic
1038613113 8:29071728-29071750 GGTCCCGGAGTGGCTCCGAGAGG - Exonic
1040055841 8:43056352-43056374 GGCCACCGAGGGGGTCGGGGAGG + Exonic
1044246628 8:89954958-89954980 GGTCCTAGAGGGAGTGAGAGCGG + Intronic
1049612442 8:143561836-143561858 GGTCCCCGGGGCGGTCAGGAGGG - Intronic
1061043376 9:128152032-128152054 AGTCCCCGAGGGGATGGGAGAGG - Intronic
1061122790 9:128654455-128654477 GGTCCCAGGTGAGGTCAGAGAGG - Intronic
1062261507 9:135665370-135665392 GGTCCCCGAGGGGGTCAGAGGGG - Intronic
1062595946 9:137299314-137299336 GACCCCCTAGCGGGTCAGAGTGG + Intergenic
1185462588 X:339804-339826 GGAGCCGGAGGGGGTGAGAGGGG + Intronic
1188107236 X:26159937-26159959 TGTCCCCGTGAGAGTCAGAGAGG + Intergenic
1189992479 X:46608090-46608112 GGGCCCTGAGGGGGTCAGAGAGG - Intronic
1190533849 X:51407355-51407377 GGTGCCCGAGGGGGGCAGCCAGG + Exonic
1195790603 X:108580682-108580704 GGTCCCCCAGGTGGTGAGAAAGG + Exonic
1199850343 X:151721541-151721563 GGGCCCGGAGTGGGGCAGAGGGG + Intronic
1200064570 X:153498283-153498305 GGTCCCTGAGGTGTTCAGATGGG + Intronic