ID: 1062261507

View in Genome Browser
Species Human (GRCh38)
Location 9:135665370-135665392
Sequence GGTCCCCGAGGGGGTCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062261507_1062261522 12 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261522 9:135665405-135665427 AAGTCCGGCCCAACCCTGGGCGG 0: 1
1: 0
2: 0
3: 6
4: 82
1062261507_1062261520 8 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261520 9:135665401-135665423 TCTGAAGTCCGGCCCAACCCTGG 0: 1
1: 0
2: 0
3: 10
4: 95
1062261507_1062261525 18 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261525 9:135665411-135665433 GGCCCAACCCTGGGCGGAGGAGG 0: 1
1: 0
2: 3
3: 12
4: 277
1062261507_1062261526 19 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261526 9:135665412-135665434 GCCCAACCCTGGGCGGAGGAGGG 0: 1
1: 0
2: 2
3: 18
4: 258
1062261507_1062261521 9 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261521 9:135665402-135665424 CTGAAGTCCGGCCCAACCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 86
1062261507_1062261514 -3 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261514 9:135665390-135665412 ACCCCACCTCCTCTGAAGTCCGG 0: 1
1: 0
2: 0
3: 20
4: 221
1062261507_1062261531 30 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261507_1062261523 15 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062261507 Original CRISPR GGTCCCCGAGGGGGTCAGAG GGG (reversed) Intronic