ID: 1062261514

View in Genome Browser
Species Human (GRCh38)
Location 9:135665390-135665412
Sequence ACCCCACCTCCTCTGAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 221}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062261501_1062261514 8 Left 1062261501 9:135665359-135665381 CCTCCGCTGTCCCCCTCTGACCC 0: 1
1: 0
2: 1
3: 33
4: 530
Right 1062261514 9:135665390-135665412 ACCCCACCTCCTCTGAAGTCCGG 0: 1
1: 0
2: 0
3: 20
4: 221
1062261509_1062261514 -5 Left 1062261509 9:135665372-135665394 CCTCTGACCCCCTCGGGGACCCC 0: 1
1: 0
2: 2
3: 13
4: 262
Right 1062261514 9:135665390-135665412 ACCCCACCTCCTCTGAAGTCCGG 0: 1
1: 0
2: 0
3: 20
4: 221
1062261508_1062261514 -4 Left 1062261508 9:135665371-135665393 CCCTCTGACCCCCTCGGGGACCC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1062261514 9:135665390-135665412 ACCCCACCTCCTCTGAAGTCCGG 0: 1
1: 0
2: 0
3: 20
4: 221
1062261506_1062261514 -2 Left 1062261506 9:135665369-135665391 CCCCCTCTGACCCCCTCGGGGAC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1062261514 9:135665390-135665412 ACCCCACCTCCTCTGAAGTCCGG 0: 1
1: 0
2: 0
3: 20
4: 221
1062261507_1062261514 -3 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261514 9:135665390-135665412 ACCCCACCTCCTCTGAAGTCCGG 0: 1
1: 0
2: 0
3: 20
4: 221
1062261502_1062261514 5 Left 1062261502 9:135665362-135665384 CCGCTGTCCCCCTCTGACCCCCT 0: 1
1: 0
2: 9
3: 84
4: 1084
Right 1062261514 9:135665390-135665412 ACCCCACCTCCTCTGAAGTCCGG 0: 1
1: 0
2: 0
3: 20
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062261514 Original CRISPR ACCCCACCTCCTCTGAAGTC CGG Intronic