ID: 1062261523

View in Genome Browser
Species Human (GRCh38)
Location 9:135665408-135665430
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 154}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062261508_1062261523 14 Left 1062261508 9:135665371-135665393 CCCTCTGACCCCCTCGGGGACCC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261507_1062261523 15 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261506_1062261523 16 Left 1062261506 9:135665369-135665391 CCCCCTCTGACCCCCTCGGGGAC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261512_1062261523 4 Left 1062261512 9:135665381-135665403 CCCTCGGGGACCCCACCTCCTCT 0: 1
1: 0
2: 1
3: 24
4: 200
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261502_1062261523 23 Left 1062261502 9:135665362-135665384 CCGCTGTCCCCCTCTGACCCCCT 0: 1
1: 0
2: 9
3: 84
4: 1084
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261501_1062261523 26 Left 1062261501 9:135665359-135665381 CCTCCGCTGTCCCCCTCTGACCC 0: 1
1: 0
2: 1
3: 33
4: 530
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261511_1062261523 5 Left 1062261511 9:135665380-135665402 CCCCTCGGGGACCCCACCTCCTC 0: 1
1: 0
2: 2
3: 31
4: 344
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261513_1062261523 3 Left 1062261513 9:135665382-135665404 CCTCGGGGACCCCACCTCCTCTG 0: 1
1: 0
2: 4
3: 27
4: 335
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261509_1062261523 13 Left 1062261509 9:135665372-135665394 CCTCTGACCCCCTCGGGGACCCC 0: 1
1: 0
2: 2
3: 13
4: 262
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261515_1062261523 -6 Left 1062261515 9:135665391-135665413 CCCCACCTCCTCTGAAGTCCGGC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261517_1062261523 -8 Left 1062261517 9:135665393-135665415 CCACCTCCTCTGAAGTCCGGCCC 0: 1
1: 0
2: 0
3: 19
4: 242
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261516_1062261523 -7 Left 1062261516 9:135665392-135665414 CCCACCTCCTCTGAAGTCCGGCC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154
1062261510_1062261523 6 Left 1062261510 9:135665379-135665401 CCCCCTCGGGGACCCCACCTCCT 0: 1
1: 0
2: 2
3: 45
4: 349
Right 1062261523 9:135665408-135665430 TCCGGCCCAACCCTGGGCGGAGG 0: 1
1: 1
2: 0
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type