ID: 1062261524

View in Genome Browser
Species Human (GRCh38)
Location 9:135665409-135665431
Sequence TCCTCCGCCCAGGGTTGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 226}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062261524_1062261535 4 Left 1062261524 9:135665409-135665431 CCGGCCCAACCCTGGGCGGAGGA 0: 1
1: 0
2: 0
3: 35
4: 226
Right 1062261535 9:135665436-135665458 CTCGCAGTGGCCCTGGGGTTTGG 0: 1
1: 0
2: 2
3: 24
4: 281
1062261524_1062261540 22 Left 1062261524 9:135665409-135665431 CCGGCCCAACCCTGGGCGGAGGA 0: 1
1: 0
2: 0
3: 35
4: 226
Right 1062261540 9:135665454-135665476 TTTGGAGAGGTGGTTCCCGTTGG 0: 1
1: 0
2: 0
3: 6
4: 89
1062261524_1062261532 -3 Left 1062261524 9:135665409-135665431 CCGGCCCAACCCTGGGCGGAGGA 0: 1
1: 0
2: 0
3: 35
4: 226
Right 1062261532 9:135665429-135665451 GGAGGGTCTCGCAGTGGCCCTGG 0: 1
1: 0
2: 3
3: 39
4: 505
1062261524_1062261536 9 Left 1062261524 9:135665409-135665431 CCGGCCCAACCCTGGGCGGAGGA 0: 1
1: 0
2: 0
3: 35
4: 226
Right 1062261536 9:135665441-135665463 AGTGGCCCTGGGGTTTGGAGAGG 0: 1
1: 0
2: 3
3: 31
4: 394
1062261524_1062261534 -1 Left 1062261524 9:135665409-135665431 CCGGCCCAACCCTGGGCGGAGGA 0: 1
1: 0
2: 0
3: 35
4: 226
Right 1062261534 9:135665431-135665453 AGGGTCTCGCAGTGGCCCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 244
1062261524_1062261533 -2 Left 1062261524 9:135665409-135665431 CCGGCCCAACCCTGGGCGGAGGA 0: 1
1: 0
2: 0
3: 35
4: 226
Right 1062261533 9:135665430-135665452 GAGGGTCTCGCAGTGGCCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 154
1062261524_1062261537 12 Left 1062261524 9:135665409-135665431 CCGGCCCAACCCTGGGCGGAGGA 0: 1
1: 0
2: 0
3: 35
4: 226
Right 1062261537 9:135665444-135665466 GGCCCTGGGGTTTGGAGAGGTGG 0: 1
1: 1
2: 11
3: 71
4: 573
1062261524_1062261531 -9 Left 1062261524 9:135665409-135665431 CCGGCCCAACCCTGGGCGGAGGA 0: 1
1: 0
2: 0
3: 35
4: 226
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062261524 Original CRISPR TCCTCCGCCCAGGGTTGGGC CGG (reversed) Intronic