ID: 1062261531

View in Genome Browser
Species Human (GRCh38)
Location 9:135665423-135665445
Sequence GGCGGAGGAGGGTCTCGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 190}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062261516_1062261531 8 Left 1062261516 9:135665392-135665414 CCCACCTCCTCTGAAGTCCGGCC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261517_1062261531 7 Left 1062261517 9:135665393-135665415 CCACCTCCTCTGAAGTCCGGCCC 0: 1
1: 0
2: 0
3: 19
4: 242
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261509_1062261531 28 Left 1062261509 9:135665372-135665394 CCTCTGACCCCCTCGGGGACCCC 0: 1
1: 0
2: 2
3: 13
4: 262
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261508_1062261531 29 Left 1062261508 9:135665371-135665393 CCCTCTGACCCCCTCGGGGACCC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261510_1062261531 21 Left 1062261510 9:135665379-135665401 CCCCCTCGGGGACCCCACCTCCT 0: 1
1: 0
2: 2
3: 45
4: 349
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261518_1062261531 4 Left 1062261518 9:135665396-135665418 CCTCCTCTGAAGTCCGGCCCAAC 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261515_1062261531 9 Left 1062261515 9:135665391-135665413 CCCCACCTCCTCTGAAGTCCGGC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261524_1062261531 -9 Left 1062261524 9:135665409-135665431 CCGGCCCAACCCTGGGCGGAGGA 0: 1
1: 0
2: 0
3: 35
4: 226
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261513_1062261531 18 Left 1062261513 9:135665382-135665404 CCTCGGGGACCCCACCTCCTCTG 0: 1
1: 0
2: 4
3: 27
4: 335
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261507_1062261531 30 Left 1062261507 9:135665370-135665392 CCCCTCTGACCCCCTCGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261511_1062261531 20 Left 1062261511 9:135665380-135665402 CCCCTCGGGGACCCCACCTCCTC 0: 1
1: 0
2: 2
3: 31
4: 344
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261519_1062261531 1 Left 1062261519 9:135665399-135665421 CCTCTGAAGTCCGGCCCAACCCT 0: 1
1: 0
2: 2
3: 9
4: 150
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190
1062261512_1062261531 19 Left 1062261512 9:135665381-135665403 CCCTCGGGGACCCCACCTCCTCT 0: 1
1: 0
2: 1
3: 24
4: 200
Right 1062261531 9:135665423-135665445 GGCGGAGGAGGGTCTCGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062261531 Original CRISPR GGCGGAGGAGGGTCTCGCAG TGG Intronic