ID: 1062262063

View in Genome Browser
Species Human (GRCh38)
Location 9:135667730-135667752
Sequence GAGCCAAGGCTGCCAGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062262060_1062262063 -10 Left 1062262060 9:135667717-135667739 CCTCGGAGGAGCAGAGCCAAGGC No data
Right 1062262063 9:135667730-135667752 GAGCCAAGGCTGCCAGAAAGGGG No data
1062262053_1062262063 24 Left 1062262053 9:135667683-135667705 CCACTCGGCGGGGCCCGTTGGTG No data
Right 1062262063 9:135667730-135667752 GAGCCAAGGCTGCCAGAAAGGGG No data
1062262056_1062262063 10 Left 1062262056 9:135667697-135667719 CCGTTGGTGCACAAAGCTGGCCT No data
Right 1062262063 9:135667730-135667752 GAGCCAAGGCTGCCAGAAAGGGG No data
1062262052_1062262063 25 Left 1062262052 9:135667682-135667704 CCCACTCGGCGGGGCCCGTTGGT No data
Right 1062262063 9:135667730-135667752 GAGCCAAGGCTGCCAGAAAGGGG No data
1062262055_1062262063 11 Left 1062262055 9:135667696-135667718 CCCGTTGGTGCACAAAGCTGGCC No data
Right 1062262063 9:135667730-135667752 GAGCCAAGGCTGCCAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062262063 Original CRISPR GAGCCAAGGCTGCCAGAAAG GGG Intergenic
No off target data available for this crispr