ID: 1062265801

View in Genome Browser
Species Human (GRCh38)
Location 9:135685948-135685970
Sequence GCGCTCCTTGGCTGGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062265791_1062265801 12 Left 1062265791 9:135685913-135685935 CCTGGGGTGGGCAGCTCTGCTCC No data
Right 1062265801 9:135685948-135685970 GCGCTCCTTGGCTGGCTCCCTGG No data
1062265797_1062265801 -10 Left 1062265797 9:135685935-135685957 CCGGGTGGCCTTGGCGCTCCTTG No data
Right 1062265801 9:135685948-135685970 GCGCTCCTTGGCTGGCTCCCTGG No data
1062265796_1062265801 -9 Left 1062265796 9:135685934-135685956 CCCGGGTGGCCTTGGCGCTCCTT No data
Right 1062265801 9:135685948-135685970 GCGCTCCTTGGCTGGCTCCCTGG No data
1062265788_1062265801 26 Left 1062265788 9:135685899-135685921 CCAGATCGCTTCTACCTGGGGTG No data
Right 1062265801 9:135685948-135685970 GCGCTCCTTGGCTGGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062265801 Original CRISPR GCGCTCCTTGGCTGGCTCCC TGG Intergenic
No off target data available for this crispr