ID: 1062266110

View in Genome Browser
Species Human (GRCh38)
Location 9:135687287-135687309
Sequence CCTTCCACTGGGAGGGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062266110_1062266124 12 Left 1062266110 9:135687287-135687309 CCCCACACCCTCCCAGTGGAAGG No data
Right 1062266124 9:135687322-135687344 GCGCTGTGACCAGCATGTGATGG No data
1062266110_1062266125 13 Left 1062266110 9:135687287-135687309 CCCCACACCCTCCCAGTGGAAGG No data
Right 1062266125 9:135687323-135687345 CGCTGTGACCAGCATGTGATGGG No data
1062266110_1062266126 19 Left 1062266110 9:135687287-135687309 CCCCACACCCTCCCAGTGGAAGG No data
Right 1062266126 9:135687329-135687351 GACCAGCATGTGATGGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062266110 Original CRISPR CCTTCCACTGGGAGGGTGTG GGG (reversed) Intergenic
No off target data available for this crispr