ID: 1062266227

View in Genome Browser
Species Human (GRCh38)
Location 9:135687691-135687713
Sequence CTGGGACAAGATGCTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062266227_1062266239 13 Left 1062266227 9:135687691-135687713 CCAACCTCAGCATCTTGTCCCAG No data
Right 1062266239 9:135687727-135687749 TGGGGCCTTCCCTGCCCTCAGGG No data
1062266227_1062266231 -10 Left 1062266227 9:135687691-135687713 CCAACCTCAGCATCTTGTCCCAG No data
Right 1062266231 9:135687704-135687726 CTTGTCCCAGAGCCAGTGGCGGG No data
1062266227_1062266235 -5 Left 1062266227 9:135687691-135687713 CCAACCTCAGCATCTTGTCCCAG No data
Right 1062266235 9:135687709-135687731 CCCAGAGCCAGTGGCGGGTGGGG No data
1062266227_1062266233 -6 Left 1062266227 9:135687691-135687713 CCAACCTCAGCATCTTGTCCCAG No data
Right 1062266233 9:135687708-135687730 TCCCAGAGCCAGTGGCGGGTGGG No data
1062266227_1062266232 -7 Left 1062266227 9:135687691-135687713 CCAACCTCAGCATCTTGTCCCAG No data
Right 1062266232 9:135687707-135687729 GTCCCAGAGCCAGTGGCGGGTGG No data
1062266227_1062266238 12 Left 1062266227 9:135687691-135687713 CCAACCTCAGCATCTTGTCCCAG No data
Right 1062266238 9:135687726-135687748 GTGGGGCCTTCCCTGCCCTCAGG No data
1062266227_1062266241 18 Left 1062266227 9:135687691-135687713 CCAACCTCAGCATCTTGTCCCAG No data
Right 1062266241 9:135687732-135687754 CCTTCCCTGCCCTCAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062266227 Original CRISPR CTGGGACAAGATGCTGAGGT TGG (reversed) Intergenic
No off target data available for this crispr