ID: 1062266468

View in Genome Browser
Species Human (GRCh38)
Location 9:135688620-135688642
Sequence TGCAGGAACTGTGACCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062266468_1062266476 29 Left 1062266468 9:135688620-135688642 CCTGCAGGGTCACAGTTCCTGCA No data
Right 1062266476 9:135688672-135688694 GGCTGGACCCCCGTCCTGCAGGG No data
1062266468_1062266472 8 Left 1062266468 9:135688620-135688642 CCTGCAGGGTCACAGTTCCTGCA No data
Right 1062266472 9:135688651-135688673 GCCACTGCTCGATGTCAGCGAGG No data
1062266468_1062266474 12 Left 1062266468 9:135688620-135688642 CCTGCAGGGTCACAGTTCCTGCA No data
Right 1062266474 9:135688655-135688677 CTGCTCGATGTCAGCGAGGCTGG No data
1062266468_1062266475 28 Left 1062266468 9:135688620-135688642 CCTGCAGGGTCACAGTTCCTGCA No data
Right 1062266475 9:135688671-135688693 AGGCTGGACCCCCGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062266468 Original CRISPR TGCAGGAACTGTGACCCTGC AGG (reversed) Intergenic
No off target data available for this crispr