ID: 1062266481

View in Genome Browser
Species Human (GRCh38)
Location 9:135688686-135688708
Sequence TGCAGGAACTGTGACCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062266481_1062266485 8 Left 1062266481 9:135688686-135688708 CCTGCAGGGTCACAGTTCCTGCA No data
Right 1062266485 9:135688717-135688739 GCCACTGCTCGATGTCAGCGAGG No data
1062266481_1062266489 29 Left 1062266481 9:135688686-135688708 CCTGCAGGGTCACAGTTCCTGCA No data
Right 1062266489 9:135688738-135688760 GGCTGGACCCCCGTCCTGCAGGG No data
1062266481_1062266487 12 Left 1062266481 9:135688686-135688708 CCTGCAGGGTCACAGTTCCTGCA No data
Right 1062266487 9:135688721-135688743 CTGCTCGATGTCAGCGAGGCTGG No data
1062266481_1062266488 28 Left 1062266481 9:135688686-135688708 CCTGCAGGGTCACAGTTCCTGCA No data
Right 1062266488 9:135688737-135688759 AGGCTGGACCCCCGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062266481 Original CRISPR TGCAGGAACTGTGACCCTGC AGG (reversed) Intergenic
No off target data available for this crispr