ID: 1062266682

View in Genome Browser
Species Human (GRCh38)
Location 9:135689732-135689754
Sequence CTTTGGTGAGGGAGGTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062266682_1062266697 29 Left 1062266682 9:135689732-135689754 CCCTCTCACCTCCCTCACCAAAG No data
Right 1062266697 9:135689784-135689806 TGTCCATTCCCAAGGCCCATGGG No data
1062266682_1062266696 28 Left 1062266682 9:135689732-135689754 CCCTCTCACCTCCCTCACCAAAG No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data
1062266682_1062266695 21 Left 1062266682 9:135689732-135689754 CCCTCTCACCTCCCTCACCAAAG No data
Right 1062266695 9:135689776-135689798 GACTCGGATGTCCATTCCCAAGG No data
1062266682_1062266689 5 Left 1062266682 9:135689732-135689754 CCCTCTCACCTCCCTCACCAAAG No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062266682 Original CRISPR CTTTGGTGAGGGAGGTGAGA GGG (reversed) Intergenic
No off target data available for this crispr