ID: 1062266689

View in Genome Browser
Species Human (GRCh38)
Location 9:135689760-135689782
Sequence AATCCCGCACCTCCCAGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062266682_1062266689 5 Left 1062266682 9:135689732-135689754 CCCTCTCACCTCCCTCACCAAAG No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data
1062266683_1062266689 4 Left 1062266683 9:135689733-135689755 CCTCTCACCTCCCTCACCAAAGG No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data
1062266681_1062266689 6 Left 1062266681 9:135689731-135689753 CCCCTCTCACCTCCCTCACCAAA No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data
1062266679_1062266689 10 Left 1062266679 9:135689727-135689749 CCTCCCCCTCTCACCTCCCTCAC No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data
1062266678_1062266689 14 Left 1062266678 9:135689723-135689745 CCAGCCTCCCCCTCTCACCTCCC No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data
1062266685_1062266689 -3 Left 1062266685 9:135689740-135689762 CCTCCCTCACCAAAGGACAGAAT No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data
1062266677_1062266689 17 Left 1062266677 9:135689720-135689742 CCGCCAGCCTCCCCCTCTCACCT No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data
1062266687_1062266689 -7 Left 1062266687 9:135689744-135689766 CCTCACCAAAGGACAGAATCCCG No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data
1062266686_1062266689 -6 Left 1062266686 9:135689743-135689765 CCCTCACCAAAGGACAGAATCCC No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data
1062266675_1062266689 21 Left 1062266675 9:135689716-135689738 CCCACCGCCAGCCTCCCCCTCTC No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data
1062266680_1062266689 7 Left 1062266680 9:135689730-135689752 CCCCCTCTCACCTCCCTCACCAA No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data
1062266676_1062266689 20 Left 1062266676 9:135689717-135689739 CCACCGCCAGCCTCCCCCTCTCA No data
Right 1062266689 9:135689760-135689782 AATCCCGCACCTCCCAGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062266689 Original CRISPR AATCCCGCACCTCCCAGACT CGG Intergenic
No off target data available for this crispr