ID: 1062266696

View in Genome Browser
Species Human (GRCh38)
Location 9:135689783-135689805
Sequence ATGTCCATTCCCAAGGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062266681_1062266696 29 Left 1062266681 9:135689731-135689753 CCCCTCTCACCTCCCTCACCAAA No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data
1062266690_1062266696 -3 Left 1062266690 9:135689763-135689785 CCCGCACCTCCCAGACTCGGATG No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data
1062266688_1062266696 11 Left 1062266688 9:135689749-135689771 CCAAAGGACAGAATCCCGCACCT No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data
1062266686_1062266696 17 Left 1062266686 9:135689743-135689765 CCCTCACCAAAGGACAGAATCCC No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data
1062266685_1062266696 20 Left 1062266685 9:135689740-135689762 CCTCCCTCACCAAAGGACAGAAT No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data
1062266687_1062266696 16 Left 1062266687 9:135689744-135689766 CCTCACCAAAGGACAGAATCCCG No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data
1062266683_1062266696 27 Left 1062266683 9:135689733-135689755 CCTCTCACCTCCCTCACCAAAGG No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data
1062266682_1062266696 28 Left 1062266682 9:135689732-135689754 CCCTCTCACCTCCCTCACCAAAG No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data
1062266692_1062266696 -9 Left 1062266692 9:135689769-135689791 CCTCCCAGACTCGGATGTCCATT No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data
1062266680_1062266696 30 Left 1062266680 9:135689730-135689752 CCCCCTCTCACCTCCCTCACCAA No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data
1062266691_1062266696 -4 Left 1062266691 9:135689764-135689786 CCGCACCTCCCAGACTCGGATGT No data
Right 1062266696 9:135689783-135689805 ATGTCCATTCCCAAGGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062266696 Original CRISPR ATGTCCATTCCCAAGGCCCA TGG Intergenic
No off target data available for this crispr