ID: 1062267332

View in Genome Browser
Species Human (GRCh38)
Location 9:135693201-135693223
Sequence GGCCTCACGGTCTTGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 305}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062267332_1062267343 22 Left 1062267332 9:135693201-135693223 CCAGGCACCAAGACCGTGAGGCC 0: 1
1: 0
2: 1
3: 9
4: 305
Right 1062267343 9:135693246-135693268 CCCACAGCACCCCTACCCCAGGG 0: 1
1: 1
2: 6
3: 63
4: 442
1062267332_1062267341 21 Left 1062267332 9:135693201-135693223 CCAGGCACCAAGACCGTGAGGCC 0: 1
1: 0
2: 1
3: 9
4: 305
Right 1062267341 9:135693245-135693267 TCCCACAGCACCCCTACCCCAGG 0: 1
1: 0
2: 3
3: 45
4: 416
1062267332_1062267336 -8 Left 1062267332 9:135693201-135693223 CCAGGCACCAAGACCGTGAGGCC 0: 1
1: 0
2: 1
3: 9
4: 305
Right 1062267336 9:135693216-135693238 GTGAGGCCACATCGCCTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 127
1062267332_1062267345 29 Left 1062267332 9:135693201-135693223 CCAGGCACCAAGACCGTGAGGCC 0: 1
1: 0
2: 1
3: 9
4: 305
Right 1062267345 9:135693253-135693275 CACCCCTACCCCAGGGCACCAGG 0: 1
1: 0
2: 6
3: 49
4: 434
1062267332_1062267335 -9 Left 1062267332 9:135693201-135693223 CCAGGCACCAAGACCGTGAGGCC 0: 1
1: 0
2: 1
3: 9
4: 305
Right 1062267335 9:135693215-135693237 CGTGAGGCCACATCGCCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 81
1062267332_1062267338 -2 Left 1062267332 9:135693201-135693223 CCAGGCACCAAGACCGTGAGGCC 0: 1
1: 0
2: 1
3: 9
4: 305
Right 1062267338 9:135693222-135693244 CCACATCGCCTCCAGGGAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062267332 Original CRISPR GGCCTCACGGTCTTGGTGCC TGG (reversed) Intergenic