ID: 1062268420

View in Genome Browser
Species Human (GRCh38)
Location 9:135697951-135697973
Sequence AGGCTCCTCTCCCCTCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062268420_1062268429 29 Left 1062268420 9:135697951-135697973 CCTTGGAGAGGGGAGAGGAGCCT No data
Right 1062268429 9:135698003-135698025 TAGGGGGTGCTCAGCCAGGGAGG No data
1062268420_1062268427 25 Left 1062268420 9:135697951-135697973 CCTTGGAGAGGGGAGAGGAGCCT No data
Right 1062268427 9:135697999-135698021 GATCTAGGGGGTGCTCAGCCAGG No data
1062268420_1062268424 11 Left 1062268420 9:135697951-135697973 CCTTGGAGAGGGGAGAGGAGCCT No data
Right 1062268424 9:135697985-135698007 ACGTGCAGAGAAATGATCTAGGG No data
1062268420_1062268425 12 Left 1062268420 9:135697951-135697973 CCTTGGAGAGGGGAGAGGAGCCT No data
Right 1062268425 9:135697986-135698008 CGTGCAGAGAAATGATCTAGGGG No data
1062268420_1062268428 26 Left 1062268420 9:135697951-135697973 CCTTGGAGAGGGGAGAGGAGCCT No data
Right 1062268428 9:135698000-135698022 ATCTAGGGGGTGCTCAGCCAGGG No data
1062268420_1062268426 13 Left 1062268420 9:135697951-135697973 CCTTGGAGAGGGGAGAGGAGCCT No data
Right 1062268426 9:135697987-135698009 GTGCAGAGAAATGATCTAGGGGG No data
1062268420_1062268423 10 Left 1062268420 9:135697951-135697973 CCTTGGAGAGGGGAGAGGAGCCT No data
Right 1062268423 9:135697984-135698006 GACGTGCAGAGAAATGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062268420 Original CRISPR AGGCTCCTCTCCCCTCTCCA AGG (reversed) Intronic