ID: 1062268484

View in Genome Browser
Species Human (GRCh38)
Location 9:135698280-135698302
Sequence GTCCTCCGGCATCACGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062268484_1062268490 23 Left 1062268484 9:135698280-135698302 CCATCACCGTGATGCCGGAGGAC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1062268490 9:135698326-135698348 CACAGCGTGCTGCTCCTGACTGG 0: 1
1: 0
2: 0
3: 14
4: 130
1062268484_1062268491 24 Left 1062268484 9:135698280-135698302 CCATCACCGTGATGCCGGAGGAC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1062268491 9:135698327-135698349 ACAGCGTGCTGCTCCTGACTGGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062268484 Original CRISPR GTCCTCCGGCATCACGGTGA TGG (reversed) Intronic
900177685 1:1298087-1298109 GTCATCCACCACCACGGTGAGGG + Exonic
900216563 1:1485126-1485148 GACGTCCCGCATCACGGTGCTGG + Exonic
908256226 1:62305705-62305727 ACCCTCCTGCAACACGGTGAAGG + Intronic
924749587 1:246873511-246873533 TTTCTCCTGCATCACAGTGAAGG + Intronic
1084495326 11:69500107-69500129 CGCCTCCGGCAGCACTGTGATGG + Intergenic
1085403108 11:76246271-76246293 GTCCTCAGGGAGCTCGGTGAAGG - Intergenic
1089534108 11:119150021-119150043 GTCCTCCAGCGTCACGGCCATGG - Exonic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1099735124 12:86557502-86557524 GTCCTCAGGCACCATGGTGGTGG - Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1106409506 13:29501429-29501451 GTCCTCCTGCAGCACTGGGAGGG + Intronic
1107565350 13:41597784-41597806 GTCCTCCCCCATCTCAGTGAAGG + Intronic
1110852438 13:80261068-80261090 GTGCTGCTGCATCACGGAGATGG + Intergenic
1112280195 13:98056181-98056203 GTCCTCCAGCTTCACTGAGAGGG + Intergenic
1119392113 14:74297941-74297963 GTCATCCCGCAGCACGTTGAGGG + Exonic
1121457374 14:94047022-94047044 GTCCTGAGGCAGCAAGGTGAGGG - Exonic
1121529383 14:94641634-94641656 CTCCTCAGGCACCACGGTGAGGG - Intergenic
1129456139 15:75677040-75677062 GGCCTTTGCCATCACGGTGAGGG - Exonic
1133677796 16:8091786-8091808 GTCATCAGGCATTATGGTGAAGG - Intergenic
1142210563 16:88806508-88806530 GTCCTCCGGCACCACCATGGCGG - Exonic
1142919453 17:3171667-3171689 ATCCTCTGGCATCTAGGTGAAGG - Intergenic
1145289824 17:21534332-21534354 GGGCTCCAGCATCACAGTGAAGG + Exonic
1145784873 17:27587300-27587322 GTCCTCCCACATCAAGGAGAGGG - Intronic
1151384816 17:73748587-73748609 GTCCTTCAGCAGCCCGGTGAGGG + Intergenic
1153900846 18:9615197-9615219 TTCCTCGTGCAGCACGGTGAAGG + Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
929675981 2:43930191-43930213 GTACTCCGGCTGCACCGTGATGG + Intronic
1170546306 20:17437994-17438016 GTCCTCTGGGAGCACGGTGTGGG - Intronic
1180748802 22:18110709-18110731 GCCCCCCGGCATCACAGTGCCGG - Intronic
1181464622 22:23104191-23104213 GTCCTCCGTCATCCCGCTGCAGG - Intronic
1181547094 22:23608244-23608266 GGCCTCTGGCAGCATGGTGAGGG - Intergenic
949606865 3:5662760-5662782 AAACTCTGGCATCACGGTGATGG + Intergenic
951427899 3:22569874-22569896 GTCCTCAGGCAACAGGGTGCTGG + Intergenic
956146695 3:66198064-66198086 GTCAGCCAGCATCATGGTGAAGG + Intronic
959073384 3:101724896-101724918 GCTCTCCGGCGTCGCGGTGAGGG + Intronic
962820541 3:139044312-139044334 GACCTCGGGGATCACGATGAGGG + Exonic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
972567960 4:40285815-40285837 GTCCTCCGTCAGCACCCTGAAGG - Intergenic
1001280221 5:170381449-170381471 GTCCTCTGGAATCACTGTGAAGG - Intronic
1002060091 5:176620838-176620860 TTCCTCCTGCATCACCGGGATGG + Exonic
1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG + Exonic
1007345106 6:41223223-41223245 GTCCTCAGAAATCACAGTGACGG + Intergenic
1017840767 6:158221003-158221025 GTCCTCCGGCCTCACTGTGTTGG + Intergenic
1019157414 6:170048629-170048651 GTCCTCGGGGAGCACGGTGGGGG + Intergenic
1019285035 7:219145-219167 GGCTTCCTGCATCACGGAGAAGG - Intronic
1019307662 7:343534-343556 GTCCTCTGGTCTCACGGTGCTGG - Intergenic
1023368873 7:39492108-39492130 GTCCTCCGGCATAAGGGTTGAGG + Intronic
1023694339 7:42829340-42829362 GTCTTACAGCATCACTGTGAAGG - Intergenic
1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG + Intronic
1032983778 7:137315109-137315131 GTTCTCGGGCTTGACGGTGATGG + Intronic
1035160012 7:156943514-156943536 GACTTACGGCCTCACGGTGATGG - Intergenic
1051779864 9:20678578-20678600 GGCCTCCTGCAGCACTGTGAAGG - Intronic
1061546870 9:131309533-131309555 GTCCATCAGCATCACAGTGAGGG - Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1192260519 X:69503895-69503917 GTCCTCGGGCAGGACGGTGAGGG + Intergenic