ID: 1062268490

View in Genome Browser
Species Human (GRCh38)
Location 9:135698326-135698348
Sequence CACAGCGTGCTGCTCCTGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062268483_1062268490 24 Left 1062268483 9:135698279-135698301 CCCATCACCGTGATGCCGGAGGA 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1062268490 9:135698326-135698348 CACAGCGTGCTGCTCCTGACTGG 0: 1
1: 0
2: 0
3: 14
4: 130
1062268485_1062268490 17 Left 1062268485 9:135698286-135698308 CCGTGATGCCGGAGGACTGACGG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1062268490 9:135698326-135698348 CACAGCGTGCTGCTCCTGACTGG 0: 1
1: 0
2: 0
3: 14
4: 130
1062268487_1062268490 9 Left 1062268487 9:135698294-135698316 CCGGAGGACTGACGGCGTCTACC 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1062268490 9:135698326-135698348 CACAGCGTGCTGCTCCTGACTGG 0: 1
1: 0
2: 0
3: 14
4: 130
1062268484_1062268490 23 Left 1062268484 9:135698280-135698302 CCATCACCGTGATGCCGGAGGAC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1062268490 9:135698326-135698348 CACAGCGTGCTGCTCCTGACTGG 0: 1
1: 0
2: 0
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062268490 Original CRISPR CACAGCGTGCTGCTCCTGAC TGG Exonic
900112640 1:1015003-1015025 CACAGCCTGCTCCACCTGCCTGG + Intergenic
900368231 1:2320161-2320183 CACAGGGAGCTGCTCCTGCTCGG - Intergenic
904048550 1:27623962-27623984 CACAGGGTGGTGCACCTGGCAGG - Intronic
904284108 1:29443152-29443174 CCCAGGGTGCTGCTCCAGCCGGG + Intergenic
904494356 1:30878302-30878324 CACAGCTTATTGCACCTGACGGG + Intronic
905460304 1:38118516-38118538 CCCAGGGTGCTGCCTCTGACAGG + Intergenic
905903221 1:41596069-41596091 CACATCGTGGGGCTCCTGCCTGG - Intronic
907311966 1:53543956-53543978 CACAGCGTGCTTCTCCTCAGGGG - Intronic
913115041 1:115689310-115689332 CACACCCTGCTGCTACTGCCAGG - Intronic
916689951 1:167180545-167180567 AATGGCGTGCTGCTGCTGACGGG - Intergenic
918039086 1:180901339-180901361 CACTGCCTGCAACTCCTGACGGG - Intergenic
920011879 1:202873934-202873956 CACAGCGTCCTCCTCCTCCCTGG + Intergenic
920268286 1:204743335-204743357 CAGAGCGTTTTGCTTCTGACTGG - Intergenic
923384225 1:233450644-233450666 CAGAGCATGCTGCTCCTTACTGG + Intergenic
923756325 1:236794537-236794559 CACAGGGAGCTTCTCCTGACTGG + Intergenic
924439432 1:244074121-244074143 CACAGCGGTCCTCTCCTGACAGG - Intergenic
1067183884 10:44011003-44011025 CACAGAGGGCAGCCCCTGACTGG - Intergenic
1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG + Intronic
1073056916 10:100709206-100709228 CACAGTGTGCTGGCCCAGACTGG + Intergenic
1073544111 10:104334770-104334792 CACCCCATGCTGCTCCTGCCTGG + Intronic
1075551310 10:123394870-123394892 CACAGCGTGGTGCTGCAGGCTGG + Intergenic
1076338349 10:129725703-129725725 CACAGGGTGCTGCTCCAATCTGG - Intronic
1077325600 11:1962656-1962678 CGCAGGGTGCGGCTCCTGACAGG - Intronic
1078547256 11:12255479-12255501 CCCCGCGTTCTGCTCCTGGCTGG + Intronic
1082238592 11:49850569-49850591 CCCAGCGTGGTGCTGCTGGCTGG + Intergenic
1082243554 11:49893761-49893783 CCCAGCGTGGTGCTGCTGGCTGG - Intergenic
1084489953 11:69472814-69472836 CACAGCCTGCTGCTCCTTGGAGG - Intergenic
1084743362 11:71153121-71153143 CCCGGCGTGCTGGTCCTCACGGG - Intronic
1088706996 11:112472868-112472890 CACAGCGTGGAGCCTCTGACAGG + Intergenic
1090995245 11:131860261-131860283 CACACAGTGCTGCTCATGGCTGG + Intronic
1091282786 11:134391447-134391469 CGCAGCCTGCTGCTTCTGCCTGG + Exonic
1202808580 11_KI270721v1_random:17835-17857 CGCAGGGTGCGGCTCCTGACAGG - Intergenic
1096413628 12:51394176-51394198 CCCAGCCTGGTGCTCCTGAGAGG + Intronic
1096780036 12:53986278-53986300 CGCAGTGTGCTGCACCGGACGGG + Intronic
1102349073 12:112179002-112179024 CACGGGGTGCTGCTCCTTCCCGG + Exonic
1102571170 12:113827799-113827821 CAAACCCTGCTGCTCCTGGCTGG + Intronic
1103567501 12:121823826-121823848 CACCGCGGGCTGCTACAGACTGG - Intronic
1104475451 12:129067245-129067267 CACAGAGTGCTGGCCCTGAGGGG + Intergenic
1107491367 13:40882839-40882861 CACATCCTGCTGCTGCTGGCTGG + Intergenic
1112492639 13:99880997-99881019 CTCAGCATGCTGCTCCCGTCTGG + Intronic
1113179023 13:107603935-107603957 CACAGCCTCCTGCACGTGACTGG - Intronic
1113728722 13:112624696-112624718 CACAGCGTGTTCATCCTGCCTGG - Intergenic
1124711250 15:32014204-32014226 CACAGCCTCCTGCTCTTGAAGGG + Intergenic
1125477382 15:40056139-40056161 CACAGCTTGATGCTCCTTTCGGG + Intergenic
1131050374 15:89343587-89343609 CCCTCCGTGCTGTTCCTGACTGG - Intergenic
1138044223 16:53704084-53704106 CTCAGCGTCCTGCTCCCGTCTGG - Exonic
1141601757 16:85130931-85130953 CACAGAGTCCTGTTCCTGCCTGG - Intergenic
1142331732 16:89458806-89458828 CTCAGCTTCCTGCTGCTGACTGG + Intronic
1143372705 17:6450225-6450247 CCCAGCGTGCTGTTAATGACGGG - Intronic
1147660968 17:42116957-42116979 CACATCCTGCTGCTCCGAACTGG + Intronic
1149528375 17:57375918-57375940 CTCAGCCTGCTGCTCCTGGGCGG - Intronic
1151704330 17:75758654-75758676 CACCGCCTGCTGGTCCTCACAGG - Intronic
1152226389 17:79094752-79094774 CACAGTGTGCTGACCCTGACGGG + Intronic
1152841933 17:82575187-82575209 CCCTGCCTGCTGCTCCTGCCGGG + Intronic
1158015453 18:52777632-52777654 CACTGCTTGCTGCTTCTGATGGG - Intronic
1160142318 18:76336593-76336615 CACAGCTGGCTTCTCATGACAGG - Intergenic
1162833508 19:13301519-13301541 CCCAGGGTGCTGCTGCTCACTGG + Intronic
1163823734 19:19511215-19511237 CGAAGGGTGCTGCTCCTGACTGG - Intergenic
1164143263 19:22493255-22493277 CCCAGCACGCTGCTTCTGACAGG + Intronic
1164517036 19:28945347-28945369 CACAGTGTGCTTCTCCTGCCAGG - Intergenic
1166799743 19:45449364-45449386 CACAGCGTCCAGCTCCTCACTGG - Intronic
1168315726 19:55483993-55484015 CAGAGCGTGCTGGTGCTGAGCGG + Exonic
928155848 2:28875752-28875774 GTCAGCGTCCTGCTCCTGTCTGG + Intergenic
929160418 2:38826635-38826657 CACAGCCTGCTGCTCTTCACTGG + Exonic
932708851 2:74047572-74047594 CAGAGCCTTCTGCTCCTGGCTGG + Exonic
934751581 2:96797392-96797414 CAGAGCCTGCTGCTCCTGCGTGG + Intronic
934765602 2:96878456-96878478 CACAGCTTGCTGATGCTGGCCGG - Exonic
935095547 2:99940974-99940996 CCCAGAGTGCTGCACCAGACAGG - Intronic
937857727 2:126684642-126684664 CACAGCGTGCTCCTGATGGCAGG + Intronic
937957077 2:127427510-127427532 CACAGCCTGCTCCTCATGAGTGG - Intronic
941373859 2:164703177-164703199 CGCAGTGCACTGCTCCTGACTGG + Exonic
941953036 2:171176285-171176307 CACAGTGTGCTGCTCAACACTGG - Intronic
942234658 2:173892371-173892393 CCCAGCTTTCTGCTCCCGACAGG + Intergenic
947228942 2:227866240-227866262 CACAGCAGACTGCTCCTGCCTGG + Intergenic
948341130 2:237252982-237253004 CACACGGTGCTCCTCCTGGCTGG + Intergenic
1168805024 20:667450-667472 CACATCGTGCTGCTCCTCTCTGG + Intronic
1169131599 20:3168673-3168695 CACTGCCTGGTGCTCCTGCCCGG - Intronic
1174115084 20:48221274-48221296 CACAGGCTGCTTCTCCTGAAAGG - Intergenic
1174405029 20:50297224-50297246 CACAGCGGGCTCCTCCTAATAGG + Intergenic
1176107919 20:63398240-63398262 CACCGCCTGCTGCTCCGGAGAGG - Intergenic
1177823780 21:26060381-26060403 CACCGAGTGCTGGTCCTGGCTGG + Intronic
1180248607 21:46564736-46564758 CTCAGCTGGCTTCTCCTGACTGG + Intronic
1180670551 22:17549302-17549324 CACAGTGTGATGCTGCAGACGGG + Exonic
1181264129 22:21620502-21620524 CTGAGGGTGCTGGTCCTGACAGG + Intronic
1181844873 22:25699064-25699086 CACAGGGTTTTGCTCCTGAAAGG - Intronic
1182705068 22:32271832-32271854 CACAGCGGGATCTTCCTGACAGG - Intergenic
1184509543 22:44925663-44925685 CACCGCCTGCTGCTCTTGGCTGG + Intronic
951625833 3:24662643-24662665 CACTGCAAGCTGCTCCTGGCAGG - Intergenic
956211822 3:66809494-66809516 AACAACTTCCTGCTCCTGACAGG + Intergenic
958446544 3:94222442-94222464 CACTGGGTGCTGCTCCTTTCTGG + Intergenic
960733671 3:120754168-120754190 AACAGCATGCTTCTCCTGAAGGG + Intronic
968461608 4:728727-728749 TACAGCTGGCGGCTCCTGACAGG - Intronic
968886954 4:3340216-3340238 CACAGCGCCCGGCTCCTGGCAGG - Intronic
970605023 4:17671448-17671470 CACAGCTTCCTGCTTCTTACTGG + Intronic
975498167 4:75057397-75057419 CACAAGGGGCTGCTCCAGACAGG - Intergenic
980825101 4:138063469-138063491 CACAGCTGGCTGCTACTGCCAGG + Intergenic
982754699 4:159204392-159204414 CATAACCTGCTGCTCCTGACAGG - Intronic
985883404 5:2657617-2657639 CACAGCGTCTTCCTCCTGAAGGG + Intergenic
985947775 5:3200297-3200319 CACACCCTCCTGCTGCTGACAGG + Intergenic
987116419 5:14730036-14730058 CACAGCGGGCTGCTTCTGTTGGG - Intronic
988830563 5:34982942-34982964 ACCAGAGTGCTGCTCATGACAGG - Intergenic
993932324 5:93955005-93955027 CACACCATGCTGCTGCTGCCAGG + Intronic
995286743 5:110397836-110397858 CACAGCATGTTGCTTCTGTCTGG + Intronic
997462015 5:134059195-134059217 CCCAGTCTGCTGCTCCTGTCTGG - Intergenic
1000509364 5:162163390-162163412 CACAACATGCTGCTCATCACTGG + Intergenic
1004550727 6:16644681-16644703 CACAGCGTGCTGCTCTATGCTGG + Intronic
1006854421 6:37123324-37123346 CAAAGCCTGCAGCTCCTGTCTGG - Intergenic
1013048944 6:106512831-106512853 AGCAGCGAGCTGCTCTTGACCGG - Exonic
1013667874 6:112366699-112366721 CCCGGCGTCCTGCTCCTGGCTGG + Intergenic
1018064397 6:160115478-160115500 CACAGCGTTCCCCTTCTGACAGG + Intergenic
1019192742 6:170262704-170262726 CAGCGGCTGCTGCTCCTGACGGG - Intergenic
1019530056 7:1498891-1498913 CACAGCGTGGTCTTCCTGCCGGG - Intronic
1019897249 7:3992071-3992093 CACAGCCAGCTCCTCCTGGCAGG + Intronic
1021352023 7:19605627-19605649 CACAGCTGGCTGCCCCTGGCTGG - Intergenic
1022480811 7:30741896-30741918 GACAGAGGGCTGCTCCTGAGGGG - Intronic
1024520706 7:50303062-50303084 CACAGGGCGCTCCTCCTCACAGG + Intergenic
1024944849 7:54798251-54798273 CACATCGAGCTGGTCATGACTGG + Intergenic
1027402304 7:77821895-77821917 CACAGCAGGCTGCTCCTGGTAGG - Intronic
1029172888 7:98643337-98643359 CACAAAGGGCTGCTCATGACAGG + Intergenic
1029249144 7:99223603-99223625 CACTGCGAGCTCCTCCTGCCGGG - Intergenic
1029584500 7:101461829-101461851 CACAGTGTGCTGGCCCAGACTGG + Intronic
1033314126 7:140283660-140283682 CACATGGTGCTGCTCCTCACTGG + Intergenic
1035370941 7:158378509-158378531 CACAGTGAGCTGCTCCCCACAGG + Intronic
1037796780 8:22002125-22002147 CACAGGCTGCTGCTCCTGCCTGG + Exonic
1038533568 8:28338049-28338071 CATAGCGTGGAGCTCCTGCCTGG - Intronic
1039721462 8:40168962-40168984 CAGAGCTTGCTGCTGCTGATGGG + Intergenic
1040434824 8:47380200-47380222 CAACGCGTGCTGCCCCTGCCTGG + Intronic
1043672249 8:82901620-82901642 CAGAGCGTGCAGCTCCTTGCAGG - Intergenic
1044072335 8:87778111-87778133 CACAGCTAGCTGCTGCTGCCAGG + Intergenic
1044475297 8:92618817-92618839 CACAGCCTGCTGAGCCTCACAGG + Intergenic
1048578134 8:135709103-135709125 CACAGTGTGGTCCTCCTGTCAGG - Intergenic
1049140962 8:140953722-140953744 CACAGTGTTGTGCTCTTGACTGG - Intronic
1049193198 8:141300324-141300346 CTCAGCGTGCTGTTTCTGAGTGG + Intronic
1051054925 9:12973488-12973510 CACAGCGTCCTCTTCCTGCCTGG - Intergenic
1056927420 9:90846789-90846811 CACAGCATTCTGCTGCTGGCTGG - Intronic
1060536372 9:124392288-124392310 CAGAGCCTGCTGCTCCTGCGTGG - Intronic
1061457742 9:130711688-130711710 CCCAGAGCGCTGCACCTGACAGG - Intergenic
1062268490 9:135698326-135698348 CACAGCGTGCTGCTCCTGACTGG + Exonic
1062468312 9:136691234-136691256 CACAGGGTCCTTCTCCTGCCAGG + Intergenic
1188861615 X:35263812-35263834 CACATCATGCTGTTCCTGTCAGG + Intergenic
1190160324 X:48027439-48027461 CACAGCAAGCTCCACCTGACAGG + Intronic
1194912124 X:99658579-99658601 CACAACGTGCAGGTTCTGACAGG - Intergenic
1196513816 X:116546414-116546436 CTCAGCCTGCTGCTGCTGGCTGG + Intergenic
1198160706 X:134005121-134005143 CACAGCATGCAGCTCCACACTGG + Intergenic
1199543417 X:148982577-148982599 CAGAGGGTGCTGCTCCTGGAAGG - Intronic