ID: 1062268491

View in Genome Browser
Species Human (GRCh38)
Location 9:135698327-135698349
Sequence ACAGCGTGCTGCTCCTGACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062268487_1062268491 10 Left 1062268487 9:135698294-135698316 CCGGAGGACTGACGGCGTCTACC 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1062268491 9:135698327-135698349 ACAGCGTGCTGCTCCTGACTGGG 0: 1
1: 0
2: 0
3: 10
4: 122
1062268485_1062268491 18 Left 1062268485 9:135698286-135698308 CCGTGATGCCGGAGGACTGACGG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1062268491 9:135698327-135698349 ACAGCGTGCTGCTCCTGACTGGG 0: 1
1: 0
2: 0
3: 10
4: 122
1062268484_1062268491 24 Left 1062268484 9:135698280-135698302 CCATCACCGTGATGCCGGAGGAC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1062268491 9:135698327-135698349 ACAGCGTGCTGCTCCTGACTGGG 0: 1
1: 0
2: 0
3: 10
4: 122
1062268483_1062268491 25 Left 1062268483 9:135698279-135698301 CCCATCACCGTGATGCCGGAGGA 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1062268491 9:135698327-135698349 ACAGCGTGCTGCTCCTGACTGGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062268491 Original CRISPR ACAGCGTGCTGCTCCTGACT GGG Exonic
900112641 1:1015004-1015026 ACAGCCTGCTCCACCTGCCTGGG + Intergenic
900230530 1:1554745-1554767 CCAGCGTGCTGCACCTGACATGG - Intronic
904649385 1:31993232-31993254 ACATCGTGATCCTCCTGCCTCGG - Intergenic
905257281 1:36693068-36693090 ATAGCGGGCTTCTCCTGTCTAGG + Intergenic
907323432 1:53619885-53619907 ACTGGGTTCTGGTCCTGACTTGG - Intronic
907830462 1:58060037-58060059 CCAGCCTGCTCCTCCTGGCTTGG - Intronic
908331275 1:63073712-63073734 CCAGTGTGCTGCGCCTGAGTTGG - Intergenic
910313448 1:85854933-85854955 ACAGCGTGTTCCACCTGCCTCGG + Intronic
911751097 1:101499230-101499252 ACAGGTTGCTGCTGCTGGCTGGG - Intergenic
919084634 1:192907453-192907475 ACAGCGAGCTGCTGGTTACTTGG + Intergenic
920268221 1:204742939-204742961 ACTGTCTGCTGCTTCTGACTAGG - Intergenic
1063434283 10:6018073-6018095 TCAGCGTCCTCCTCCTGAGTGGG - Exonic
1064139433 10:12777982-12778004 GCAGCGTCCTGCCCCTGGCTTGG - Intronic
1064745501 10:18474579-18474601 ACAGCGCACGGCTCCTGACCTGG + Intronic
1066132692 10:32409594-32409616 CCAGTGTGCAGCTCCAGACTGGG + Intergenic
1066752317 10:38670758-38670780 ACATCGTGATCCTCCTGCCTTGG - Intergenic
1067750030 10:48965370-48965392 ACTCCATGCTGCTCCTGACAGGG + Intronic
1072421727 10:95295295-95295317 AAAGCGTGTGACTCCTGACTGGG + Intergenic
1073834837 10:107429383-107429405 CCTGCCTGCTGCTCCTTACTTGG + Intergenic
1075011510 10:118874318-118874340 ACTTCCTGCTACTCCTGACTTGG - Intergenic
1076338348 10:129725702-129725724 ACAGGGTGCTGCTCCAATCTGGG - Intronic
1081122036 11:39278856-39278878 AGTGCCTGCTGCTCATGACTAGG + Intergenic
1082238594 11:49850570-49850592 CCAGCGTGGTGCTGCTGGCTGGG + Intergenic
1082243552 11:49893760-49893782 CCAGCGTGGTGCTGCTGGCTGGG - Intergenic
1088976115 11:114817856-114817878 ACAGCATCCTGCTCCTGCCTCGG - Intergenic
1089354401 11:117840425-117840447 GCATCGTTCTGCTCCTCACTGGG + Intronic
1090995246 11:131860262-131860284 ACACAGTGCTGCTCATGGCTGGG + Intronic
1091282787 11:134391448-134391470 GCAGCCTGCTGCTTCTGCCTGGG + Exonic
1092915723 12:13187299-13187321 ACACCCTGCTGCTTCAGACTAGG - Intergenic
1096080334 12:48828460-48828482 CCAGCCTGCTGCTCCAGTCTTGG - Exonic
1096229178 12:49888013-49888035 ACAGCTGGCTGCTCCAGACCTGG - Intronic
1100541749 12:95563738-95563760 ACCTCGTGATGCTCCTGCCTCGG - Intergenic
1101343648 12:103865121-103865143 ACAGCCTGGTCCTCCTCACTTGG - Intergenic
1102455461 12:113068138-113068160 ACTGAATGCTGCTCATGACTAGG - Intronic
1102571171 12:113827800-113827822 AAACCCTGCTGCTCCTGGCTGGG + Intronic
1103567500 12:121823825-121823847 ACCGCGGGCTGCTACAGACTGGG - Intronic
1103922966 12:124408940-124408962 ACAACGTGCTGCCGCTGACTTGG - Intronic
1104704779 12:130934858-130934880 ACAGCTTGGTGTTCGTGACTTGG - Intergenic
1106556871 13:30817345-30817367 ATAGCGTGTTGCACCAGACTGGG - Intergenic
1112391725 13:98991301-98991323 ACCTCGTGATGCTCCTGCCTCGG + Intronic
1112723673 13:102277414-102277436 CCAGCATGCTGCTCTTGCCTGGG - Intronic
1113647448 13:112008966-112008988 ACAGCCCCCTGCTCCTGACGTGG - Intergenic
1118599661 14:67463074-67463096 ACAGGGTGGTGATCCTGAGTTGG + Intronic
1122259315 14:100503221-100503243 ACAGCATGCTGGGCGTGACTGGG - Intronic
1126072356 15:44876080-44876102 GCAGCTTGCTGCTGCTGGCTGGG + Intergenic
1126734874 15:51720938-51720960 ACAGGTTGCTGCTGCTGGCTGGG - Exonic
1128277591 15:66366518-66366540 ACCTCGTGATCCTCCTGACTCGG - Intronic
1128332239 15:66763369-66763391 ACAGGCAGTTGCTCCTGACTTGG + Intronic
1130007748 15:80117453-80117475 ACCTCGTGATCCTCCTGACTTGG + Intronic
1131050372 15:89343586-89343608 CCTCCGTGCTGTTCCTGACTGGG - Intergenic
1136099065 16:27980049-27980071 ACAGCCTCCTGCTTCTGGCTTGG - Intronic
1136189503 16:28607213-28607235 GCAGGGTTCAGCTCCTGACTTGG - Intronic
1136609869 16:31359705-31359727 ACAATGTCCTGCTCCTGTCTTGG - Exonic
1137038217 16:35585554-35585576 ACAGGTTGCTGCTGCTGATTTGG + Intergenic
1141601756 16:85130930-85130952 ACAGAGTCCTGTTCCTGCCTGGG - Intergenic
1144384473 17:14736641-14736663 ACTGTGTGCTCCTACTGACTTGG + Intergenic
1152226390 17:79094753-79094775 ACAGTGTGCTGACCCTGACGGGG + Intronic
1153545793 18:6203824-6203846 ACATTCTGCTGCTCTTGACTGGG + Intronic
1160027235 18:75228541-75228563 ACAGCATCATGCTCCTGACACGG - Intronic
1161058407 19:2201860-2201882 ACAGCGTGCAGGTCTTGACCAGG + Intronic
1161219703 19:3112823-3112845 GCAGTGTGCAGCTCCAGACTCGG - Intronic
1161520773 19:4722619-4722641 ACAGTCTGCAGCTCCTGAGTGGG - Intronic
1163823733 19:19511214-19511236 GAAGGGTGCTGCTCCTGACTGGG - Intergenic
1166799742 19:45449363-45449385 ACAGCGTCCAGCTCCTCACTGGG - Intronic
1167561540 19:50228903-50228925 ACAGGGTGGTGCTCCTTACCCGG - Intronic
925177296 2:1794554-1794576 ACAGGGTGCCGCCCCTGCCTTGG - Intronic
928155849 2:28875753-28875775 TCAGCGTCCTGCTCCTGTCTGGG + Intergenic
934751582 2:96797393-96797415 AGAGCCTGCTGCTCCTGCGTGGG + Intronic
937357854 2:121209399-121209421 ATAAGGTGCTGCTCCTGGCTGGG - Intergenic
937957076 2:127427509-127427531 ACAGCCTGCTCCTCATGAGTGGG - Intronic
942314332 2:174683465-174683487 ACAACGTGCTGCTCTTCCCTCGG + Intergenic
947189076 2:227482754-227482776 TCAGTGTGCTGCTCTTAACTAGG - Intronic
1168805025 20:667451-667473 ACATCGTGCTGCTCCTCTCTGGG + Intronic
1174977104 20:55348553-55348575 ACAGAGAGCTGCTTCTGGCTGGG - Intergenic
1175328860 20:58148919-58148941 ACCCCATGCTGCTCCTGCCTCGG + Intergenic
1176511691 21:7753433-7753455 ACAGCGTGATGCTACAGAGTTGG + Intronic
1177823781 21:26060382-26060404 ACCGAGTGCTGGTCCTGGCTGGG + Intronic
1178645805 21:34383961-34383983 ACAGCGTGATGCTACAGAGTTGG + Intronic
1180143198 21:45905487-45905509 ACAGTGTGCTGCCGCTGACCTGG - Intronic
1180248608 21:46564737-46564759 TCAGCTGGCTTCTCCTGACTGGG + Intronic
950960609 3:17102091-17102113 ACAGCTTGCTGCTCCAGTGTTGG - Intergenic
951453713 3:22867643-22867665 ACAGATTGCTGATCCTGCCTTGG - Intergenic
955205346 3:56890842-56890864 AGAGAGTGCAGCTCCTGACTTGG + Intronic
957705475 3:83775344-83775366 ACATCGTGATCCTCCTGTCTCGG - Intergenic
958047870 3:88306808-88306830 ACAGAATGATGCTCATGACTAGG - Intergenic
961544027 3:127619463-127619485 ACATCGTGATCCTCCTGCCTCGG - Intronic
968001191 3:195207978-195208000 AAAGCCTGCTGCTTCTGTCTTGG - Intronic
969483386 4:7458713-7458735 ACAGTGGGCTCCTCCTGGCTGGG - Intronic
970605024 4:17671449-17671471 ACAGCTTCCTGCTTCTTACTGGG + Intronic
978144754 4:105359351-105359373 ACAGGTTGCTGCTGCTGGCTCGG - Intergenic
981875620 4:149540786-149540808 ATGGCGTGAGGCTCCTGACTAGG - Intergenic
982893494 4:160886117-160886139 ACAGGTTGCTGCTGCTGGCTGGG + Intergenic
988830561 5:34982941-34982963 CCAGAGTGCTGCTCATGACAGGG - Intergenic
989121602 5:38009980-38010002 CCAGCGTGCTGCTCCTCAGGAGG + Intergenic
989657518 5:43760423-43760445 ACTCCATGCTGCTCCTGGCTGGG + Intergenic
990330239 5:54718694-54718716 AAAGGGTGCAGCTTCTGACTGGG + Intergenic
992273018 5:75085409-75085431 CCAGTGTGCTGCTCCAGCCTGGG - Intronic
995108026 5:108397730-108397752 ACTTCGTGCTTCTCCTGCCTTGG + Intergenic
997462013 5:134059194-134059216 CCAGTCTGCTGCTCCTGTCTGGG - Intergenic
999509510 5:152233857-152233879 ACCTCGTGCTCCTCCTGCCTTGG + Intergenic
1000174426 5:158737082-158737104 ACAGCCTGGTGCCCCTGCCTCGG + Intronic
1002842260 6:916230-916252 ACAGGTTGCTGCTGCTGGCTTGG - Intergenic
1004158449 6:13191675-13191697 TCAAAGGGCTGCTCCTGACTTGG + Intronic
1005850347 6:29816157-29816179 ACAGTGTGCAGCTGCAGACTTGG + Intergenic
1006854420 6:37123323-37123345 AAAGCCTGCAGCTCCTGTCTGGG - Intergenic
1013048943 6:106512830-106512852 GCAGCGAGCTGCTCTTGACCGGG - Exonic
1013667876 6:112366700-112366722 CCGGCGTCCTGCTCCTGGCTGGG + Intergenic
1017484819 6:154892718-154892740 ACAGCGTGGTTCTGCTCACTTGG + Intronic
1021006065 7:15396566-15396588 ACAGCTTGCCGCTCCTTGCTTGG + Intronic
1021352022 7:19605626-19605648 ACAGCTGGCTGCCCCTGGCTGGG - Intergenic
1023542364 7:41279638-41279660 GCAGGGTGCTGCTCCTCACTTGG + Intergenic
1024516879 7:50266907-50266929 CCAGCCTGCTGCTCCTGGCCAGG - Intergenic
1025112302 7:56228850-56228872 ACAGCTTGGTGGTTCTGACTAGG + Intergenic
1025834971 7:65085734-65085756 CCAGCTTCCTGCTCCTGGCTTGG + Intergenic
1025904742 7:65775213-65775235 CCAGCTTCCTGCTCCTGGCTTGG + Intergenic
1028560361 7:92168457-92168479 ACAGCATGGTGCTGCTGAATAGG - Intronic
1029459647 7:100687511-100687533 TCCGCGTGCTGCCCCTGCCTCGG + Exonic
1029584501 7:101461830-101461852 ACAGTGTGCTGGCCCAGACTGGG + Intronic
1033314127 7:140283661-140283683 ACATGGTGCTGCTCCTCACTGGG + Intergenic
1038603023 8:28967488-28967510 ACAGAGTGCTGCTCCATACAAGG + Intronic
1040434825 8:47380201-47380223 AACGCGTGCTGCCCCTGCCTGGG + Intronic
1042042315 8:64605650-64605672 TCAGCGTGTAGCTCCTGTCTAGG + Intronic
1043764954 8:84119561-84119583 ACCTAGTGCTGCTCATGACTGGG - Intergenic
1049193199 8:141300325-141300347 TCAGCGTGCTGTTTCTGAGTGGG + Intronic
1056340296 9:85623519-85623541 ACATCGTGATCCTCCTGCCTCGG - Intronic
1056531619 9:87493065-87493087 ACAGGTTGCTGCTCCTCACCAGG - Intergenic
1056667438 9:88592133-88592155 ACAGAGAGTTGTTCCTGACTTGG - Intergenic
1056927419 9:90846788-90846810 ACAGCATTCTGCTGCTGGCTGGG - Intronic
1060536371 9:124392287-124392309 AGAGCCTGCTGCTCCTGCGTGGG - Intronic
1061252599 9:129435496-129435518 AGAGAGTGCTGCTCCTGGGTTGG + Intergenic
1062268491 9:135698327-135698349 ACAGCGTGCTGCTCCTGACTGGG + Exonic
1189900034 X:45696936-45696958 ACAGCCAGCTGCTTTTGACTTGG - Intergenic
1199585079 X:149406098-149406120 ACAGATTGCTGCTGCTGAGTTGG - Intergenic