ID: 1062270182

View in Genome Browser
Species Human (GRCh38)
Location 9:135704695-135704717
Sequence ATCAGGGCCTAGAGGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062270182_1062270192 5 Left 1062270182 9:135704695-135704717 CCTGGGACCCTCTAGGCCCTGAT 0: 1
1: 0
2: 2
3: 15
4: 190
Right 1062270192 9:135704723-135704745 CAGGCCCTGGCATCCTGCCAGGG No data
1062270182_1062270195 16 Left 1062270182 9:135704695-135704717 CCTGGGACCCTCTAGGCCCTGAT 0: 1
1: 0
2: 2
3: 15
4: 190
Right 1062270195 9:135704734-135704756 ATCCTGCCAGGGTACATGCCTGG No data
1062270182_1062270191 4 Left 1062270182 9:135704695-135704717 CCTGGGACCCTCTAGGCCCTGAT 0: 1
1: 0
2: 2
3: 15
4: 190
Right 1062270191 9:135704722-135704744 TCAGGCCCTGGCATCCTGCCAGG No data
1062270182_1062270188 -8 Left 1062270182 9:135704695-135704717 CCTGGGACCCTCTAGGCCCTGAT 0: 1
1: 0
2: 2
3: 15
4: 190
Right 1062270188 9:135704710-135704732 GCCCTGATGGGATCAGGCCCTGG No data
1062270182_1062270198 23 Left 1062270182 9:135704695-135704717 CCTGGGACCCTCTAGGCCCTGAT 0: 1
1: 0
2: 2
3: 15
4: 190
Right 1062270198 9:135704741-135704763 CAGGGTACATGCCTGGCCCAAGG No data
1062270182_1062270199 29 Left 1062270182 9:135704695-135704717 CCTGGGACCCTCTAGGCCCTGAT 0: 1
1: 0
2: 2
3: 15
4: 190
Right 1062270199 9:135704747-135704769 ACATGCCTGGCCCAAGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062270182 Original CRISPR ATCAGGGCCTAGAGGGTCCC AGG (reversed) Intronic
900375264 1:2351352-2351374 ATCAGGGATGCGAGGGTCCCTGG + Intronic
900386467 1:2413120-2413142 CTCGGGGCCTGGAAGGTCCCGGG - Intronic
900989693 1:6092654-6092676 AGGAGAACCTAGAGGGTCCCAGG - Intronic
901189932 1:7403718-7403740 ACCAGGTTCTAGATGGTCCCAGG - Intronic
902468686 1:16633129-16633151 CTCAGTGCCAGGAGGGTCCCTGG - Intergenic
903156915 1:21451667-21451689 AACAGGGCATAGTGGGTCCTGGG + Intronic
903949416 1:26986943-26986965 ATCACTTCCTAGAGGGTGCCAGG + Intergenic
904929394 1:34074361-34074383 AGCAGGGCATACAGGGTCCCTGG + Intronic
905631541 1:39521704-39521726 ATCAGGGCCAAGATGGTGTCAGG - Intronic
905666213 1:39764467-39764489 ATCAGGGCCAAGATGGTGTCAGG + Intronic
905857882 1:41326722-41326744 TTCAGAGCCAAGAGGGTGCCAGG + Intergenic
906511226 1:46411423-46411445 ATCAGGCCCCAGAGGGGCACAGG - Intronic
906672340 1:47665528-47665550 ATCAGTGCCTAGAAAGTGCCTGG + Intergenic
907845799 1:58205491-58205513 CTCAGGGCCTTGAGGGGCCATGG - Intronic
912642148 1:111357356-111357378 GTGAGGGCCTAGAAGTTCCCTGG + Intergenic
915628132 1:157129623-157129645 AGTAGAGCCAAGAGGGTCCCAGG + Intronic
918206815 1:182316823-182316845 ACCATGGCCTACAGAGTCCCCGG - Intergenic
918999055 1:191804326-191804348 CTCAGGGCCCACAGGGTCCACGG + Intergenic
919974400 1:202601332-202601354 ATCACTGCCTAGAGTGTGCCAGG + Intronic
920519715 1:206614280-206614302 ATAAAGGCCTAGTGGGTCACAGG - Intergenic
920538928 1:206762568-206762590 TTCAGGGGCTAGTGGGTCCCAGG - Intergenic
921006730 1:211101011-211101033 ATCAGGGCCAAGAGTATCCCAGG - Intronic
922043204 1:221917289-221917311 ATCTGTGGCTTGAGGGTCCCAGG + Intergenic
1070691917 10:78533348-78533370 CTCGGGGCCTGGAGGGTCACGGG - Intergenic
1070795004 10:79211292-79211314 AACAGGGCCCAGAGGCTCCCAGG - Intronic
1070834048 10:79436835-79436857 ATCTGGGCCTAGATGGCCCAGGG - Intronic
1073185871 10:101614720-101614742 AACAGAGCCTTGAGGGTCCTGGG - Intronic
1073509558 10:104034699-104034721 CCCAGGGCCTCGAGGGCCCCCGG - Exonic
1073877431 10:107941249-107941271 ATCATGGCGGAGAGGATCCCAGG + Intergenic
1075587649 10:123669118-123669140 GACTGGGCCTGGAGGGTCCCAGG - Intronic
1076832785 10:133005111-133005133 GTCTGGGGCTAGAGGCTCCCTGG - Intergenic
1077113049 11:870321-870343 AGCAGGGCCCAGGGGGTCTCAGG - Intronic
1077440055 11:2564055-2564077 ATGAGTGCCTCGAGGGGCCCTGG - Intronic
1079366875 11:19817391-19817413 ATCAGGGCTTACTAGGTCCCAGG - Intronic
1081744746 11:45464960-45464982 ATGAGAGCTTTGAGGGTCCCAGG + Intergenic
1081948748 11:47023428-47023450 ATCAGGGCCCATAGGGGACCTGG + Intronic
1085712271 11:78841013-78841035 TTGAGGGCTTACAGGGTCCCAGG - Intronic
1085714317 11:78858407-78858429 ATCAGGACCTTGAGGGCCTCTGG + Intronic
1088694962 11:112358810-112358832 TTCAATGCCTATAGGGTCCCAGG - Intergenic
1089139961 11:116276896-116276918 AGCAGTGCCTAGAAGGGCCCTGG - Intergenic
1090429520 11:126634461-126634483 ATCAGGTCCAGAAGGGTCCCAGG - Intronic
1091439360 12:500675-500697 ATGAAGGCCTGGTGGGTCCCGGG - Intronic
1091677916 12:2504718-2504740 ATTTGCACCTAGAGGGTCCCCGG + Intronic
1091869879 12:3880588-3880610 ATCAGGGACTTGAGCATCCCAGG + Intergenic
1093557848 12:20498569-20498591 ATCAGGGACTTGAGCATCCCTGG + Intronic
1094711660 12:32969852-32969874 ATCAGGGCCTCGAGCATCCATGG - Intergenic
1094832467 12:34306647-34306669 ACCAGGGACACGAGGGTCCCCGG - Intergenic
1095267345 12:40175687-40175709 ATGAGGTCATAGAGGGACCCAGG + Intergenic
1095957366 12:47814308-47814330 GTCAAGGCCTAGAGGGGACCTGG - Intronic
1103035247 12:117651333-117651355 CTCAAGTCCCAGAGGGTCCCTGG + Intronic
1105458982 13:20566771-20566793 AGGAGGGCCTAGAGGGGCTCCGG - Intergenic
1111068165 13:83124887-83124909 ATCTGGGCCTAGAGATTTCCAGG - Intergenic
1113638855 13:111943176-111943198 AACAGGGCCCAGAGGGTGCTCGG + Intergenic
1114656653 14:24319775-24319797 ATGAGGGCCTAGAGTGTCTGAGG - Exonic
1118747188 14:68782748-68782770 ATAAGGGCTTAGAGGGGCCTTGG - Intergenic
1121449750 14:93999541-93999563 AACATGGCCTGGAGGCTCCCAGG - Intergenic
1121546075 14:94764686-94764708 ATCTGGGCCAAGGGGGACCCTGG - Intergenic
1121704894 14:95984124-95984146 ATCAGTGTCTAGGGGTTCCCTGG - Intergenic
1121794366 14:96723240-96723262 TTGAGGGCCTAGATGGTGCCAGG - Intergenic
1122043447 14:99007071-99007093 CTCGGGGCCCAGAGGGTTCCCGG + Intergenic
1122084737 14:99291728-99291750 ATGATGGCCCAGAGGGTCCTAGG + Intergenic
1122397109 14:101441548-101441570 GACAGGGCCCAGAGGGACCCGGG - Intergenic
1122503483 14:102217199-102217221 TGCAGGGCCAAGTGGGTCCCAGG + Intronic
1123031505 14:105453982-105454004 AGCGGGGCCTCGAGGGTCACTGG - Intronic
1123038887 14:105482434-105482456 ACCAGGGCCTTGTGGATCCCTGG - Intergenic
1128520299 15:68370548-68370570 CCCAAGGCCTAGAGGGCCCCAGG - Intronic
1128606065 15:69037479-69037501 ATTAGTGCCTACAGGGTGCCAGG + Intronic
1132207916 15:99999142-99999164 ATCAGAACCTAGAAGGTGCCTGG - Intronic
1134207068 16:12247018-12247040 AGCAGGGCCTTGTAGGTCCCTGG + Intronic
1134402841 16:13926227-13926249 ATCTGGGCCAAGAGAGTTCCAGG - Intronic
1139928899 16:70509313-70509335 ATCAGGGTATAGAGTCTCCCTGG + Exonic
1140482846 16:75271803-75271825 ACCAGGCCCCAGAGGGTCCATGG - Intergenic
1141562254 16:84877330-84877352 ACCAGGGCCTATGGGTTCCCTGG - Intronic
1144297824 17:13895856-13895878 ATAAGGGACTTGAGCGTCCCTGG - Intergenic
1145266373 17:21381421-21381443 TGCAGGGCCCTGAGGGTCCCAGG - Intronic
1148816223 17:50329967-50329989 AGTAGGGCCCAGTGGGTCCCAGG - Intergenic
1149624053 17:58067103-58067125 TTCAGGGCCCTGAGGTTCCCTGG + Intergenic
1150335797 17:64329897-64329919 ATGTGGAGCTAGAGGGTCCCGGG - Intronic
1152431758 17:80252171-80252193 AGCAGTGGCCAGAGGGTCCCAGG + Intronic
1152619365 17:81354306-81354328 ATCAGTGCCAAGTGGGGCCCGGG + Intergenic
1152679002 17:81656111-81656133 ATCAGGGCCCAGAGCTGCCCAGG - Intronic
1156265502 18:35484707-35484729 ATCAGGGACTTGAGGTTCCATGG + Intronic
1156291865 18:35754699-35754721 ATGAGGGCCTAGGGGGTGCAAGG - Intergenic
1164616230 19:29668276-29668298 CTCAGGGCCCAGAGGCTGCCAGG + Intronic
1165419865 19:35717528-35717550 CCCAGGGCCTCGGGGGTCCCGGG + Intergenic
1166503683 19:43358654-43358676 ATCAGGGACACGTGGGTCCCAGG + Intronic
1166506771 19:43376104-43376126 ATCAGGGACACGTGGGTCCCAGG - Intergenic
1166944169 19:46387011-46387033 TTCTGGGCCTTGAGGGTGCCAGG + Intronic
1167922494 19:52793415-52793437 CTGAGGGGCTAGAGAGTCCCAGG + Intronic
1168171506 19:54592946-54592968 AACAGAGGCCAGAGGGTCCCAGG - Intronic
1168277946 19:55287371-55287393 AACAGGGCCTAGGGGGACCTGGG + Intronic
1168687859 19:58359112-58359134 AGCAGGGCCCCGAGGGGCCCTGG - Intronic
925985479 2:9211695-9211717 ATCTGGGCCTGCAGGCTCCCAGG + Intronic
927786604 2:25979284-25979306 ATTAGAGCCTGGAAGGTCCCGGG + Intronic
930038518 2:47102894-47102916 ATCAGGTCCTACAGGGTCTAGGG + Intronic
932192442 2:69752276-69752298 GACAGGTCCTAGAGGGTCCAAGG + Intronic
933692562 2:85190558-85190580 ATCAGGTGCCAGAGGTTCCCAGG - Intronic
936066933 2:109339569-109339591 TTCAGGCCCTGGAGGGTGCCTGG + Intronic
937042554 2:118833745-118833767 CTCAGGTGCTAGAGGGTCTCTGG + Intergenic
937158359 2:119737692-119737714 GTCAAGGCATTGAGGGTCCCTGG + Intergenic
937295472 2:120807362-120807384 TCCAGTGCTTAGAGGGTCCCTGG + Intronic
946200071 2:218066036-218066058 ATCAGGGCCTTGAGAGGGCCAGG + Intronic
946313020 2:218893276-218893298 ATCAGGGCCCAGGGGACCCCGGG - Exonic
946441781 2:219703090-219703112 ATAAGGGGCTAGAGGGTCCCAGG + Intergenic
947750713 2:232530599-232530621 AGCAGGGCATAGTGAGTCCCAGG + Intronic
948667913 2:239547723-239547745 ATCAGGGACTTGAGCATCCCAGG + Intergenic
949042195 2:241854567-241854589 ATCAGGGCCAAGAGGGCTCCTGG + Intronic
1171097337 20:22344183-22344205 CTTAGGGCCTCGAGGGTCTCTGG - Intergenic
1172240975 20:33412332-33412354 CTCAGGGCCTCGCGGGTCTCGGG + Exonic
1173008266 20:39157629-39157651 CTCAGGGCCTATAGGGGGCCAGG - Intergenic
1175234519 20:57500960-57500982 GTCAGATCCTAAAGGGTCCCTGG - Intronic
1175397643 20:58677907-58677929 ATAAGGTCCTAGAGGGGCCCTGG + Exonic
1175595881 20:60232306-60232328 TTCAGGGGCTTCAGGGTCCCTGG + Intergenic
1176242523 20:64081645-64081667 GTCAGGGCGCAGAGGGTCCTGGG - Intronic
1176706888 21:10124297-10124319 ATCAGGGTCGTCAGGGTCCCCGG - Intergenic
1178569150 21:33718549-33718571 ATCAGGGACTTGAGGATCCACGG + Intronic
1179448609 21:41452146-41452168 CTCAAGGCCTGGAGGGTCCAGGG + Intronic
1179474618 21:41635213-41635235 AGCAGGCCCTAGAGGGGCACGGG - Intergenic
1182444440 22:30381910-30381932 ATCATGCCCTAGAGGGTGCCGGG + Intronic
1183950761 22:41351463-41351485 AGCTGGGCCTCGGGGGTCCCTGG + Intronic
1184089566 22:42285108-42285130 AGCAGGGCCTGGAGGGGCCCTGG - Intronic
1185235966 22:49713255-49713277 ATCAGGGCCTGCAGAGTCCCAGG + Intergenic
1185328105 22:50237459-50237481 ATCAGGGAGTAGAGGGGCCCAGG + Intronic
950977857 3:17268989-17269011 ATCAGGACCTATAGGGATCCAGG + Intronic
952526868 3:34219830-34219852 CTCATGGCCTAGAGAGCCCCTGG - Intergenic
954441624 3:50525313-50525335 ATCAGGACCTGGCGGGTACCGGG + Intergenic
954442307 3:50528445-50528467 ATCGGAGCCTAGAGACTCCCAGG + Intergenic
955137705 3:56236369-56236391 TTCAGGGCCTGGATGGTCTCAGG - Intronic
955334405 3:58073097-58073119 ATCAATGCCTTGAGGGTGCCTGG + Intronic
956228732 3:66988728-66988750 AACAGGGCCTAGAGGGTGAAAGG + Intergenic
959842495 3:110994400-110994422 ATCAGGGCTTAGAGGGATTCTGG + Intergenic
961350241 3:126295880-126295902 ATCAGGGTTTAGGGGGTCCCTGG - Intergenic
962069434 3:132017849-132017871 ATCAGGGCTCAGAGGCTCCACGG + Intronic
964427989 3:156573233-156573255 GTTAAAGCCTAGAGGGTCCCAGG - Intergenic
966211923 3:177462647-177462669 ATCAGGCCCTAGAGAGGCCGGGG + Intergenic
968736089 4:2297234-2297256 GTCATGGCCTGGAGGGGCCCAGG + Intronic
971195630 4:24470504-24470526 ATCGGGGCCCGGAGGGTGCCCGG - Intergenic
973870360 4:55159988-55160010 CTCAGGACCTAGAGGGTCCCTGG + Intergenic
973910522 4:55575397-55575419 AACAGGGCCTAAAGGGTCTGTGG + Intronic
974204035 4:58675805-58675827 AGCATGGCCAAGGGGGTCCCAGG + Intergenic
981497690 4:145412113-145412135 ATTATGACCTACAGGGTCCCAGG + Intergenic
983077471 4:163343813-163343835 AGCAGGGTCTCGGGGGTCCCCGG + Intronic
985041236 4:185893720-185893742 AACAGGGGCTAGGGGTTCCCCGG + Intronic
985119232 4:186623177-186623199 GTCAGGGCCTAGAGAAACCCTGG - Intronic
985205623 4:187532423-187532445 ATCAGGGACTTGAGCATCCCAGG + Intergenic
985646731 5:1088507-1088529 AACAGGACCTGGAGGCTCCCGGG + Intronic
987409217 5:17598366-17598388 GTCTGGGCCGAGAGGATCCCTGG + Intergenic
988547723 5:32174054-32174076 AGCCGGGCCGAGAGGGTCGCAGG + Exonic
991419338 5:66425710-66425732 ACCAGGGCCCAGAGGCTTCCTGG + Intergenic
991432678 5:66564472-66564494 ATCAGGACCTAGAGGGTGTCAGG + Intergenic
992007352 5:72490929-72490951 ATCAGGGAGAAGAGGGTCTCAGG - Intronic
996995319 5:129689247-129689269 AGCAGTGTCTAGAGGATCCCAGG - Intronic
1000039290 5:157473186-157473208 ATCAGTGCCTGCAGGTTCCCTGG + Exonic
1001980780 5:176035828-176035850 ATCAGGGCCTACAGTGCCCAAGG - Intergenic
1002236680 5:177808237-177808259 ATCAGGGCCTACAGTGCCCAAGG + Intergenic
1002299425 5:178248965-178248987 CCCAGAGCCTAGAGTGTCCCCGG + Intronic
1003383511 6:5646634-5646656 ATCAGGGACTTGAGCATCCCTGG - Intronic
1003550996 6:7101818-7101840 ATCAGGGCCAAGATGATGCCTGG - Intergenic
1005438603 6:25840764-25840786 ATTAGTGACTAGAGAGTCCCTGG + Intronic
1006089641 6:31620811-31620833 ACCCGGGCCTAGGGGCTCCCCGG - Exonic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007461894 6:42025256-42025278 AGCAAGGCCAAGAGGGGCCCAGG + Intronic
1009992908 6:70865549-70865571 ATCAGGGACTTGAGCGTCCATGG + Intronic
1011989269 6:93492264-93492286 ATAAGGGCCTTGAGTGTCCATGG - Intergenic
1014120385 6:117718859-117718881 ATCAGGGACTAGGGGGATCCTGG + Intergenic
1015333356 6:132006777-132006799 ACCAGGGCCTAGAGGTGGCCTGG - Intergenic
1015629408 6:135216248-135216270 ATCAGGGACTTGAGCATCCCTGG - Intronic
1017237423 6:152131516-152131538 ATCAAGGCATAGAGGGTAGCAGG + Intronic
1023526543 7:41109428-41109450 ATCAGAGCCTTGGGGGTCCCTGG + Intergenic
1024224762 7:47317789-47317811 ATCAGGGTCTAGGGAGTCACTGG + Intronic
1024509927 7:50195924-50195946 GTCAGGGCCGTGAGGATCCCAGG - Intergenic
1024567303 7:50692218-50692240 ATCAGGGCCTTGAGCATCCTTGG + Intronic
1025607064 7:63047187-63047209 ATCCAGGCCTAGAGAGTCCTGGG - Intergenic
1028556547 7:92132289-92132311 ATAAGGGACTTGAGGATCCCTGG - Intronic
1029219817 7:98979291-98979313 ATCAGGGACTTGAGTGTCCGTGG - Intronic
1030480057 7:110091668-110091690 ATCAAGGCCTAGTAGGTGCCTGG + Intergenic
1032318912 7:130867077-130867099 CTCAGTGCCTAGAGAGTACCTGG + Intergenic
1033125024 7:138699868-138699890 ATCAGGGCCGGGTGGGTCCCCGG + Intronic
1034457121 7:151176630-151176652 ATCAGGACCTCGATGGTCCGAGG + Exonic
1035183539 7:157108290-157108312 ATCAAGGCGCAAAGGGTCCCTGG - Intergenic
1036696676 8:10979529-10979551 TTCAGGGGCTAGAGGGTCGGGGG - Intronic
1037414165 8:18630946-18630968 ATCAGGGACTTGAGTGTCCTTGG + Intronic
1037544191 8:19901894-19901916 GTCAGTGCCTTGAGGGTCTCTGG + Intronic
1038427831 8:27476179-27476201 ATCAGGGCCAACAGTGTGCCAGG + Intronic
1042387107 8:68189340-68189362 ATCAGGGCCTGTAAGGTCCTGGG + Intronic
1049265719 8:141666924-141666946 ATCAGGGCCGAGGGGGTCTCCGG - Intergenic
1049279218 8:141735795-141735817 TCCAAGGCCTAGAGGGGCCCTGG - Intergenic
1049428716 8:142549449-142549471 TGCAGGGCCTGGAGGGCCCCTGG + Intergenic
1053644187 9:40111450-40111472 ATCAGGGTCGTCAGGGTCCCCGG - Intergenic
1053761972 9:41354035-41354057 ATCAGGGTCGTCAGGGTCCCCGG + Intergenic
1054325039 9:63708685-63708707 ATCAGGGTCGTCAGGGTCCCCGG - Intergenic
1054540563 9:66265159-66265181 ATCAGGGTCGTCAGGGTCCCCGG + Intergenic
1056274286 9:84978047-84978069 ATCAGGGAATAGAGAGGCCCAGG - Intronic
1056901892 9:90607619-90607641 AGCAGGGCCGAGTGGGGCCCGGG - Intergenic
1059429350 9:114240666-114240688 AGCAGGGCAGAGAAGGTCCCTGG - Intronic
1059436908 9:114282525-114282547 TCCAGGCCCTAAAGGGTCCCGGG + Exonic
1060912624 9:127363018-127363040 ATCAGGGCCTGGCGGGTGGCAGG - Intronic
1062270182 9:135704695-135704717 ATCAGGGCCTAGAGGGTCCCAGG - Intronic
1062362304 9:136193750-136193772 GTCAGCGCCTAAAAGGTCCCGGG + Intergenic
1062459343 9:136656414-136656436 ATCAGGGCGTGGAGGGTCTTGGG - Intergenic
1062546354 9:137065292-137065314 CAGAGAGCCTAGAGGGTCCCAGG + Intronic
1202791633 9_KI270719v1_random:93170-93192 ATCAGGGTCGTCAGGGTCCCCGG - Intergenic
1187073861 X:15914857-15914879 ATCAGAGCCTGGAGGGGTCCAGG - Intergenic
1187328291 X:18312326-18312348 ATCAGGGACTTGAGTGTCCTTGG - Intronic
1190375315 X:49783352-49783374 ATCTGGGGATAGAGTGTCCCAGG - Intergenic
1190539663 X:51464087-51464109 ATCAGAGCTTGGAGGGTCCAGGG - Intergenic
1200242264 X:154503272-154503294 ATCAGGGACTTGAGCATCCCTGG - Intergenic
1201152097 Y:11100071-11100093 ACCAGGGACTCCAGGGTCCCTGG + Intergenic