ID: 1062271552

View in Genome Browser
Species Human (GRCh38)
Location 9:135712153-135712175
Sequence GCACACCCCCTAGACAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062271552_1062271564 28 Left 1062271552 9:135712153-135712175 CCGGCCTTGTCTAGGGGGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1062271564 9:135712204-135712226 AAGGGGTGTGTGAGTCCCACAGG No data
1062271552_1062271558 10 Left 1062271552 9:135712153-135712175 CCGGCCTTGTCTAGGGGGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1062271558 9:135712186-135712208 CACCTCAGCCCTGGCTCCAAGGG No data
1062271552_1062271557 9 Left 1062271552 9:135712153-135712175 CCGGCCTTGTCTAGGGGGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1062271557 9:135712185-135712207 TCACCTCAGCCCTGGCTCCAAGG No data
1062271552_1062271559 11 Left 1062271552 9:135712153-135712175 CCGGCCTTGTCTAGGGGGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1062271559 9:135712187-135712209 ACCTCAGCCCTGGCTCCAAGGGG No data
1062271552_1062271554 1 Left 1062271552 9:135712153-135712175 CCGGCCTTGTCTAGGGGGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1062271554 9:135712177-135712199 GTGTCCCGTCACCTCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062271552 Original CRISPR GCACACCCCCTAGACAAGGC CGG (reversed) Intronic
900578339 1:3395216-3395238 GGGCACCCCCGAGACAGGGCTGG - Intronic
902374640 1:16024611-16024633 GCAGACCCCCAAGAAAAGGCAGG - Intronic
902379584 1:16046383-16046405 GCAGACCCCCAAGAAGAGGCAGG - Intronic
903661413 1:24981122-24981144 ACCCATCTCCTAGACAAGGCGGG + Intergenic
904319982 1:29690303-29690325 GCACAGTCCCCAGACACGGCTGG + Intergenic
904477366 1:30773964-30773986 CCCCACACCCTAGACAAGCCTGG + Intergenic
905484650 1:38286818-38286840 GCCCATCCCTTAGACAAGGGAGG + Intergenic
917264151 1:173202126-173202148 GGCCAGCCCCTAAACAAGGCTGG + Intronic
918535134 1:185565582-185565604 GCCCACCTCCAAGAAAAGGCAGG - Intergenic
920252471 1:204630760-204630782 GCACTCCCCCTTGCCAGGGCAGG + Intronic
920301101 1:204989585-204989607 GCACACCCTCTGGGAAAGGCTGG + Intronic
1062906737 10:1184643-1184665 GCACCGCCCCCAGACCAGGCTGG - Intronic
1063278966 10:4603368-4603390 GCACAGCCTCCAGCCAAGGCCGG - Intergenic
1065281337 10:24141740-24141762 TCACAACCCGTAGATAAGGCTGG + Intronic
1074858578 10:117491893-117491915 GCCCACACCTTAGTCAAGGCAGG - Intergenic
1075394911 10:122120239-122120261 GCCCAACCCCTAGGCCAGGCGGG - Intronic
1077421041 11:2450084-2450106 GTCCACCTCCCAGACAAGGCGGG - Intronic
1077424170 11:2466688-2466710 GGAGGCCCCCTGGACAAGGCTGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1081813577 11:45926644-45926666 ACACATCCCCCAGACAAGGCTGG - Intronic
1083314100 11:61803594-61803616 GCACGGCCCCTAGACCAGACTGG + Intronic
1084204347 11:67583444-67583466 GCACACCCGCTTCACAGGGCAGG - Intergenic
1084518594 11:69649521-69649543 GAACACGCCCTAGAAAATGCAGG - Intronic
1084904625 11:72336047-72336069 GCACTCTCCCTAGGAAAGGCAGG - Intronic
1084941817 11:72617110-72617132 GCCCATCCCCTGGCCAAGGCAGG - Intronic
1102664810 12:114562894-114562916 GCACACCCCCCAGGGAAGCCGGG - Intergenic
1103977963 12:124716037-124716059 GCAGACCCCCTAGTCAAGGGTGG - Intergenic
1107335222 13:39347511-39347533 GCACACTCTCTAGATGAGGCCGG - Intronic
1107991820 13:45825480-45825502 GCACACACCCCAGGCAGGGCTGG - Intronic
1110526078 13:76538256-76538278 GCTCACACCCAAGGCAAGGCAGG + Intergenic
1112330460 13:98473618-98473640 GCACACACCCAAGACCAGCCAGG + Intronic
1113482812 13:110634066-110634088 GCAGAGCCCGTAAACAAGGCAGG - Intronic
1128916097 15:71563914-71563936 CCACACCCCCAAAACAAGTCAGG - Intronic
1129776074 15:78237282-78237304 GCACACCCTCTCGCCAGGGCAGG + Intronic
1132580363 16:681940-681962 GCACAGACCCAACACAAGGCGGG - Exonic
1132712376 16:1274928-1274950 GCACACACTCTAGAAAAGGGAGG + Intergenic
1132712381 16:1274961-1274983 GCACACACTCTAGAAAAGGGAGG + Intergenic
1132712396 16:1275065-1275087 GCACACACTCTAGAAAAGGGAGG + Intergenic
1132712434 16:1275321-1275343 GCACACACTCTAGAAAAGGGAGG + Intergenic
1132712439 16:1275354-1275376 GCACACACTCTAGAAAAGGGAGG + Intergenic
1132712461 16:1275508-1275530 GCACACACTCTAGAAAAGGGAGG + Intergenic
1132765557 16:1532628-1532650 GCACACGCCCAAGACAGTGCTGG - Intronic
1132807018 16:1779550-1779572 CCCCACCCCACAGACAAGGCAGG + Intronic
1133275811 16:4637841-4637863 CCCCACCCCCTAGACAGGGCTGG - Intronic
1135487368 16:22877970-22877992 GCCCACCCACAAGACAATGCTGG + Intronic
1142854186 17:2720987-2721009 GCACATCCCCCATTCAAGGCTGG + Intergenic
1148341851 17:46878046-46878068 GCACAGCCCCTGGACCAGGCTGG + Intronic
1148895116 17:50835127-50835149 GCACACCCCCCACAAAGGGCCGG + Intronic
1150137402 17:62703543-62703565 GCACACACCCCAGACACGGGTGG - Intronic
1152376392 17:79920954-79920976 GCCCAGCCCCCAGAGAAGGCCGG + Intergenic
1155444409 18:25895807-25895829 TCACACTCCCTTGACCAGGCTGG + Intergenic
1159609903 18:70513636-70513658 GCAGACAGCCAAGACAAGGCGGG - Intergenic
1163311821 19:16519473-16519495 CCAGACCCTCTAGACAGGGCCGG - Intronic
1165730211 19:38140333-38140355 TGACTCCCCCTAGACCAGGCTGG - Intronic
925111505 2:1342175-1342197 TCTCACTCCTTAGACAAGGCCGG + Intronic
935198915 2:100838721-100838743 GAACACCCCTTTGAGAAGGCAGG - Intronic
942376184 2:175340015-175340037 CCCCACCCCCTAGCCAAGGGAGG - Intergenic
946137931 2:217663568-217663590 GCACAGCCCTGAGACAAGGAGGG + Intronic
1170792378 20:19518731-19518753 GCACAAACCCTAGGCAAGGAGGG - Intronic
1171267412 20:23782952-23782974 GGACACCCCGTGGACAAGTCTGG + Intergenic
1173018186 20:39245658-39245680 GCACTTCTCATAGACAAGGCAGG + Intergenic
1173380922 20:42540369-42540391 GTGCACCTCCAAGACAAGGCAGG + Intronic
1174178126 20:48657706-48657728 GCACACGCCCCAGGCAAAGCCGG + Intronic
1179510668 21:41871267-41871289 GCAGAACCCCTGGACGAGGCTGG - Intronic
1181972531 22:26702826-26702848 GCACACTGCCTAGAGAAAGCTGG - Intergenic
1182279729 22:29210802-29210824 GCCCAGCCCCCAGACTAGGCCGG - Intronic
955038498 3:55292417-55292439 GCAAACCACCTCGACAAGGAAGG + Intergenic
955212084 3:56951574-56951596 GCACACCCCAGAGACATTGCTGG - Intronic
968622661 4:1610766-1610788 GCACAGCCCCATGACAGGGCAGG + Intergenic
970451435 4:16169973-16169995 GCACACCACCTAGGCGAGGGTGG + Intronic
970560172 4:17274746-17274768 TCACACCCCCAAGACTACGCTGG - Intergenic
971780660 4:31029945-31029967 ACAAACCCACTAGACTAGGCTGG + Intronic
972711977 4:41606453-41606475 GCATACGCTCTGGACAAGGCGGG + Intronic
979958967 4:126992558-126992580 GCTCATGCCCTAGACAAGACTGG - Intergenic
988091209 5:26543213-26543235 GGACTCCCCCTCCACAAGGCTGG + Intergenic
992502735 5:77357965-77357987 GGACACACCCAAGAGAAGGCTGG - Intronic
993951534 5:94182135-94182157 GCGCACCCTATAGACAATGCAGG + Intronic
994651722 5:102537636-102537658 GCACAGCCCCTAGAGTAGGGTGG - Intergenic
996933509 5:128920091-128920113 TCACACCCTCTATATAAGGCAGG + Intronic
998147956 5:139740842-139740864 GGACACCCCCCAGACCCGGCTGG + Intergenic
1002907393 6:1461325-1461347 GGAAACCACATAGACAAGGCTGG - Intergenic
1005494176 6:26374536-26374558 GCACACCCCCTTGTAAAGCCTGG + Intronic
1005498648 6:26411319-26411341 GCACACCCCCTTGCAAAGCCTGG + Intronic
1007473058 6:42103289-42103311 GCACACCCACCAGACAGAGCTGG + Exonic
1016770158 6:147840195-147840217 TCACACCCTCTAGAGAAGGCTGG + Intergenic
1016827944 6:148405372-148405394 CAAAACCCCCTAGTCAAGGCGGG - Intronic
1020083131 7:5296923-5296945 GCACGCCCCCCAGGCACGGCGGG + Exonic
1020345746 7:7161595-7161617 GCACAACCACTAGAAAAGACAGG + Intronic
1022634547 7:32119698-32119720 CCCCACCCCCTAGCCAAGGCCGG + Intronic
1023684685 7:42722082-42722104 GCACACCCAGAAGTCAAGGCAGG - Intergenic
1029073803 7:97920477-97920499 CCAGACTCCCTAGAGAAGGCAGG + Intergenic
1032091040 7:128911712-128911734 CCCCTCCCCCTAGACCAGGCAGG + Intergenic
1034964723 7:155384038-155384060 AGACACCCCCCAGAGAAGGCGGG - Intronic
1035199155 7:157248960-157248982 ACACACCCCCTAGACAGTGCTGG - Intronic
1036679931 8:10864520-10864542 GCCCACACCCTACACAGGGCTGG - Intergenic
1044761175 8:95519270-95519292 GGATACCTCCAAGACAAGGCAGG + Intergenic
1046409226 8:113817492-113817514 TCACACACCCTAGAGAGGGCGGG - Intergenic
1049647884 8:143744350-143744372 CCACAGCCCCAAGACGAGGCAGG + Intergenic
1050197251 9:3099208-3099230 GCTCAGCCCATAGTCAAGGCAGG + Intergenic
1051281704 9:15447896-15447918 GCATACCCCCTGGATAAGGATGG + Intronic
1055775638 9:79764450-79764472 GGGGAACCCCTAGACAAGGCAGG - Intergenic
1056310268 9:85333804-85333826 GAACTTCCCCTGGACAAGGCAGG - Intergenic
1062271552 9:135712153-135712175 GCACACCCCCTAGACAAGGCCGG - Intronic
1203784289 EBV:118753-118775 GCACACGCCAGAGACAAGGCAGG - Intergenic
1197750128 X:129958136-129958158 GCACACCCCTTTGGCCAGGCAGG + Intergenic