ID: 1062271820

View in Genome Browser
Species Human (GRCh38)
Location 9:135713355-135713377
Sequence CAGAACAAGGAGCAGGGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062271812_1062271820 6 Left 1062271812 9:135713326-135713348 CCAGATCCTGGGGGTTGAACCTG 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1062271820 9:135713355-135713377 CAGAACAAGGAGCAGGGTTTGGG No data
1062271813_1062271820 0 Left 1062271813 9:135713332-135713354 CCTGGGGGTTGAACCTGTGACCT 0: 1
1: 0
2: 1
3: 14
4: 136
Right 1062271820 9:135713355-135713377 CAGAACAAGGAGCAGGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062271820 Original CRISPR CAGAACAAGGAGCAGGGTTT GGG Intronic
No off target data available for this crispr