ID: 1062271820 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:135713355-135713377 |
| Sequence | CAGAACAAGGAGCAGGGTTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062271812_1062271820 | 6 | Left | 1062271812 | 9:135713326-135713348 | CCAGATCCTGGGGGTTGAACCTG | 0: 1 1: 0 2: 1 3: 12 4: 155 |
||
| Right | 1062271820 | 9:135713355-135713377 | CAGAACAAGGAGCAGGGTTTGGG | No data | ||||
| 1062271813_1062271820 | 0 | Left | 1062271813 | 9:135713332-135713354 | CCTGGGGGTTGAACCTGTGACCT | 0: 1 1: 0 2: 1 3: 14 4: 136 |
||
| Right | 1062271820 | 9:135713355-135713377 | CAGAACAAGGAGCAGGGTTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062271820 | Original CRISPR | CAGAACAAGGAGCAGGGTTT GGG | Intronic | ||
| No off target data available for this crispr | |||||