ID: 1062273121

View in Genome Browser
Species Human (GRCh38)
Location 9:135718773-135718795
Sequence CTCGGGCTTCCTGTTTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062273109_1062273121 20 Left 1062273109 9:135718730-135718752 CCAACCCCTGGCAGGCTGTGAGC 0: 1
1: 0
2: 4
3: 34
4: 289
Right 1062273121 9:135718773-135718795 CTCGGGCTTCCTGTTTCCCCCGG No data
1062273112_1062273121 14 Left 1062273112 9:135718736-135718758 CCTGGCAGGCTGTGAGCGAGCAG 0: 1
1: 0
2: 3
3: 24
4: 196
Right 1062273121 9:135718773-135718795 CTCGGGCTTCCTGTTTCCCCCGG No data
1062273111_1062273121 15 Left 1062273111 9:135718735-135718757 CCCTGGCAGGCTGTGAGCGAGCA 0: 1
1: 0
2: 2
3: 19
4: 190
Right 1062273121 9:135718773-135718795 CTCGGGCTTCCTGTTTCCCCCGG No data
1062273110_1062273121 16 Left 1062273110 9:135718734-135718756 CCCCTGGCAGGCTGTGAGCGAGC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1062273121 9:135718773-135718795 CTCGGGCTTCCTGTTTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062273121 Original CRISPR CTCGGGCTTCCTGTTTCCCC CGG Intronic
No off target data available for this crispr